View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8791_low_8 (Length: 317)
Name: NF8791_low_8
Description: NF8791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8791_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 14 - 298
Target Start/End: Original strand, 40942623 - 40942907
Alignment:
| Q |
14 |
tggtggtctattaaagatcctttggatcagaggttttgtttcattgaatgttggaacaaacttatccttattcacgattttgttcgataggtttatttag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942623 |
tggtggtctattaaagatcctttggatcagaggttttgtttcattgaatgttggaacaaacttgtccttattcacgattttgttcgataggtttatttag |
40942722 |
T |
|
| Q |
114 |
gagattgaaaacatgaataaaaatctatccaactgttatgtttgcaggcaggatatttgcttcatgatcgtgttattcggccagcggaagttggtgtaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942723 |
gagattgaaaacatgaataaaaatctatccaactgttatgtttgcaggcaggatatttgcttcatgatcgtgttattcggccagcggaagttggtgtaac |
40942822 |
T |
|
| Q |
214 |
ccaagcaaaagaaaatggcaattcagctgaatgatggtaaagataatatagctgataaggattcatatgattaagagattcctga |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40942823 |
ccaagcaaaagaaaatggcaattcagctgaatgatggtaaagataatatagctgataaggattcgtatgattaagagattcctga |
40942907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University