View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8792_high_3 (Length: 359)
Name: NF8792_high_3
Description: NF8792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8792_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 19 - 353
Target Start/End: Original strand, 6049814 - 6050148
Alignment:
| Q |
19 |
tccttgaatagaatagagtttatgctctatcattaaagcttatatttatagatttcctatataccnnnnnnnnnnnnctagatttgctaggagcccaagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
6049814 |
tccttgaatagaatagagtttatgctctatcattaaagcttatatttatagatttcctatttaccaaaaagaaaaaactagatttgctaggagcccaagg |
6049913 |
T |
|
| Q |
119 |
gaaaaatcatttctcacgaggtgtctttggtggtgattttggccaaatttttccttagactaatatgtctttacttgagtgtcaagcgtagtcactccaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6049914 |
gaaaaatcatttctcacgaggtgtctttggtggtgattttggccaaatttttccttagactaatatgtctttacttgagtgtcaagcgtagtcactccaa |
6050013 |
T |
|
| Q |
219 |
acccgaagctactaaagcaaagacttcagacctaaaaacataatcactttgtattagtaataaattttagctttgaaagaaggtctatcacatttacaga |
318 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6050014 |
acccgaagctactgaagcaaagacttcaggcctaaaaacataatcactttgtattagtaacaaattttagctttgaaagaaggtctatcacatttacaga |
6050113 |
T |
|
| Q |
319 |
aaacctaaccttaagctcttccttctaacaccaaa |
353 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6050114 |
aaacctaaccttaagctcttccttctaacgccaaa |
6050148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University