View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8792_high_6 (Length: 317)
Name: NF8792_high_6
Description: NF8792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8792_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 42933741 - 42934039
Alignment:
| Q |
1 |
tgctgcctcaacagcaattgcaactgcagcaacaatatgttgtcgatgatgtcggtattaaccctaattatgttcctttacaagaggatcttaattcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933741 |
tgctgcctcaacagcaattgcaactgcagcagcaatatgttgtcgatgatgtctgtattaaccctaattatgttcctttacaagaggatcttaattcatg |
42933840 |
T |
|
| Q |
101 |
ggcaaacaatattaatataccgttgtctcctttaactttggagggtaacaataacgaagaagacggtgaagaagatcaggaacgtgttggtgatgatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933841 |
ggcaaacaatattaatataccgttgtctcctttaactttggagggtaacaataaggaagaagatggtgaagaagatcaggaacgtgttggtgatgatcaa |
42933940 |
T |
|
| Q |
201 |
ggaaatgatcagaaacccgtttttgacctaatcaatgaaatgaattctttggataccaacagcagaagtagtattgatccggggcaccaggtttgttatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42933941 |
ggaaatgatcagaaacccgtttttgacctaatcaatgaaatgaattctttggataccaacagc---agtagtattgatccggggcaccaggtttgttatt |
42934037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University