View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8792_low_11 (Length: 285)
Name: NF8792_low_11
Description: NF8792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8792_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 270
Target Start/End: Complemental strand, 35479892 - 35479641
Alignment:
| Q |
15 |
tggtgttgcgatctgaagttactggaaattgactacttcagcagttcactttctttgcattctctggtttttgaattttgatttcgattccagaatgatt |
114 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35479892 |
tggtgtcgcgatctgaagttactggaaattgactacttcagcaattcactttctttgcattctctggtttttgaattttgatttcgattccagaatgatt |
35479793 |
T |
 |
| Q |
115 |
ttgattcttctgagatgtgttctaaagggtaaattcggaattaaggaagaacgaatgtggggcgggtccaatttttgttcttgctggatttgagtaatta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35479792 |
ttgattcttctgagatgtgttctaaagggtaaattcggaattaaggaagaacgaatgt-----gggtccaatttttgctcttgctggatttgagtaatta |
35479698 |
T |
 |
| Q |
215 |
gatacatag-attatgtctttcctatctgcaccccacatttttcgctatgttttatg |
270 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35479697 |
gatacatagaattatgtctttgctatctgcaccccacatttttcgctatgttttatg |
35479641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University