View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8792_low_12 (Length: 265)
Name: NF8792_low_12
Description: NF8792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8792_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 256
Target Start/End: Original strand, 25259608 - 25259855
Alignment:
| Q |
12 |
gagatgaattaatcactgctttgcttgataagcttacaagagaagacatgtagtagtttctttggttagttg---atagagctaactattttgtattgtt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25259608 |
gagatgaattaatcactgctttgcttgataagcttacaagagaagacatgtagtagtttctttggttagttgctaatagagctaactattttgtattgtt |
25259707 |
T |
 |
| Q |
109 |
tcttcctcacatcaagcaatgcttgttttagaggtttgttctatgaactctcaatttagtttgaagatagctttatttatgatcatcaatttagtggtaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25259708 |
tcttcctcacatcaagcaatgcttgttttagaggtttgttctatgaactctcaatttagtttgaagatagctttatttatgatcatcaatttagtggtaa |
25259807 |
T |
 |
| Q |
209 |
ttttgacatttttgaatttggatcctacactcctatataactgatgat |
256 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
25259808 |
ttttgacatttttgattttggatcctgcactcctatataactgttgat |
25259855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University