View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8792_low_15 (Length: 261)
Name: NF8792_low_15
Description: NF8792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8792_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 259
Target Start/End: Original strand, 24582955 - 24583194
Alignment:
| Q |
19 |
tagccagagattgtacgacctccatgaatctttggtattctatatgtatatatata--ccaagttcttcaacaatatggaccctcgtggttggctgaagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
24582955 |
tagccagagattgtacgacctccatgaatctttggtattctatatgtatatatatataccaagttcttcaacaatatggaccgtcgtggttgg---aagc |
24583051 |
T |
 |
| Q |
117 |
ttggacttgcctcgcttggttccaacactttcgctgctggagtattgcggtcttggagaaataggaactctactttcttctcaaatgctcggatcttaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24583052 |
ttggacttgcctcgcttggttccaacactttcgctgctggagtattgtggtcttggagaaataggaactctactttcttctcaaatgctcggatcttaac |
24583151 |
T |
 |
| Q |
217 |
ttattgtctctccatggaagctagaaatttgtctacctctctg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24583152 |
ttattgtctctccatggaagctagaaatttgtctacctctctg |
24583194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 250
Target Start/End: Original strand, 14041672 - 14041757
Alignment:
| Q |
165 |
ggtcttggagaaataggaactctactttcttctcaaatgctcggatcttaacttattgtctctccatggaagctagaaatttgtct |
250 |
Q |
| |
|
||||||||||||||| || ||||||| |||||||||||||| ||| | ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
14041672 |
ggtcttggagaaatataaattctacttgcttctcaaatgctccgatatctacttaacgtcttgccatggaagctagaaatttgtct |
14041757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 83 - 143
Target Start/End: Complemental strand, 5325835 - 5325775
Alignment:
| Q |
83 |
ttcaacaatatggaccctcgtggttggctgaagcttggacttgcctcgcttggttccaaca |
143 |
Q |
| |
|
|||||||| ||||||||||||| ||||| |||||||||||| | ||||| ||||||||| |
|
|
| T |
5325835 |
ttcaacaaaatggaccctcgtgaatggctcaagcttggacttacttcgctcagttccaaca |
5325775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University