View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8792_low_22 (Length: 204)
Name: NF8792_low_22
Description: NF8792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8792_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 27782751 - 27782576
Alignment:
| Q |
14 |
attctgtgcatctgcttcattgctttggtttgcatagtttccgagttcatgatttcttcttattttgctaccctgaccttcttgctatagtcttctgcac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27782751 |
attctgtgcatctgcttcattgctttggtttgcatagtttccgagttcatgatttcttcttattttgctgccctgaccttcttgctatagtcttctgcac |
27782652 |
T |
 |
| Q |
114 |
atatcttaacaagtatttgccagtatgtaatacacgttcatatttattatttttgataacatatctaggttgtatt |
189 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27782651 |
atatcttaacaagtatttgacagtatgtaatacacgttcatatttattatttttgataacatatctaggttgtatt |
27782576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 92 - 190
Target Start/End: Complemental strand, 27766030 - 27765932
Alignment:
| Q |
92 |
ttcttgctatagtcttctgcacatatcttaacaagtatttgccagtatgtaatacacgttcatatttattatttttgataacatatctaggttgtattt |
190 |
Q |
| |
|
||||| || |||| |||||||||| |||||||||||||||| || |||||||| || ||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
27766030 |
ttctttctctagttttctgcacatctcttaacaagtatttggcattatgtaattcatgttcatatttattatttttgatagcatatctaggctgtattt |
27765932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University