View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8792_low_23 (Length: 202)
Name: NF8792_low_23
Description: NF8792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8792_low_23 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 8e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 30 - 202
Target Start/End: Complemental strand, 10490196 - 10490024
Alignment:
| Q |
30 |
gtattcatcaaaaatcttgaccagccgggaggaaattaatgacaagttgtaattcgggtaaacttactcaggattaagggattggaggtcatcatagatg |
129 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||| || |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10490196 |
gtattcatcagaaatcttaaccagccgggagcaaatccgtggcaagttgtaattcgggtaaacttacttaggattaatggattggaggtcatcatagatg |
10490097 |
T |
 |
| Q |
130 |
attattatgttattaatcccagatagcaagcggtctgtagcgctgaacttcagaaatgctatgtcggtatagt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
10490096 |
attattatgttattaatcccagatagcaagcggcctgtagcgccgaacttcaaaaatgctatagcggtatagt |
10490024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 73 - 202
Target Start/End: Complemental strand, 10494224 - 10494096
Alignment:
| Q |
73 |
aagttgtaattcgggtaaacttactcaggattaagggattggaggtcatcatagatgattattatgttattaatcccagatagcaagcggtctgtagcgc |
172 |
Q |
| |
|
|||||||| || |||||||||||| || ||||| ||||| |||||||| |||||||| ||||||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
10494224 |
aagttgtagatcaggtaaacttacttag-attaatggatttgaggtcattatagatgactattatgttgttaatcctagatagcaagcggcatgtagcgc |
10494126 |
T |
 |
| Q |
173 |
tgaacttcagaaatgctatgtcggtatagt |
202 |
Q |
| |
|
|||| || ||||||||| ||||||||| |
|
|
| T |
10494125 |
cgaaccccaaaaatgctatagcggtatagt |
10494096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University