View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8792_low_5 (Length: 347)
Name: NF8792_low_5
Description: NF8792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8792_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 55457305 - 55457461
Alignment:
| Q |
1 |
agggcgttgttaattaaagagtagagagacgactgagcgagtttttgggaaatggcgaaattttggtgtgattttcggtttcttctctttgttgcagcct |
100 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55457305 |
agggcgctgttaattaaaga-tagagagacgactgagcgagtttttgggaaatggcgaaattttggtgtgattttcggtttcttctctttgttgcagcct |
55457403 |
T |
|
| Q |
101 |
tggtgttcatctacatccaggtgcctctatcttttcggtttcgtgtaaccttaattta |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55457404 |
tggtgttcatctacatccaggtgcctctatcttttcggtttcgtgtaaccttaattta |
55457461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 224 - 331
Target Start/End: Original strand, 55457522 - 55457629
Alignment:
| Q |
224 |
agatgagacttttcgcatcacaatcacaatatgctgatcgcctcgctgctgctgtatgtaattatactctacattttcattccatgtttgctctgctttg |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55457522 |
agatgagacttttcgcatcacaatcacaatatgctgatcgcctcgctgctgctgtatgtaattcaactctacattttcattccatgtttgctttgctttg |
55457621 |
T |
|
| Q |
324 |
cataatca |
331 |
Q |
| |
|
|||||||| |
|
|
| T |
55457622 |
cataatca |
55457629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University