View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8793_high_21 (Length: 287)

Name: NF8793_high_21
Description: NF8793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8793_high_21
NF8793_high_21
[»] chr3 (1 HSPs)
chr3 (193-266)||(49205281-49205354)


Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 193 - 266
Target Start/End: Complemental strand, 49205354 - 49205281
Alignment:
193 tccactaatcctacaccctgtccttgatttgtagtgtgttaccttttaatggttataaaattgaggcctggacg 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
49205354 tccactaatcctacaccctgtccttgatttgtagtgtgttaccttttaatggttataaagttgaggcctggacg 49205281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University