View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8793_high_30 (Length: 221)
Name: NF8793_high_30
Description: NF8793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8793_high_30 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 12 - 221
Target Start/End: Complemental strand, 32427900 - 32427691
Alignment:
| Q |
12 |
agagagattcgtgcaattggtgcgacaaaagttgccataaagcattttccttttgaataatatcgctaacaaagtcctcgtgtcttgttttagagctcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32427900 |
agagagattcgtgcaattggtgcgacaaaagttgccataaagcattttccttttgaataatatcgctaacaaagtcctcgtgtcttgttttagagctcaa |
32427801 |
T |
|
| Q |
112 |
aagccgtggaagtgtagttagttttcaatcacatcgatcgctgaatcaaaacgcagcgttcattgatccacaatatcgacgatggcagagaagaaaccca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32427800 |
aagccgtggaagtgtagttagttttcaatcacatcgatcgctgaatcaaaacgcagcgttcattgatccacaatatcgatgatggcagagaagaaaccca |
32427701 |
T |
|
| Q |
212 |
aaacaaagat |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
32427700 |
aaacaaagat |
32427691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 62 - 112
Target Start/End: Complemental strand, 40595111 - 40595061
Alignment:
| Q |
62 |
ttttgaataatatcgctaacaaagtcctcgtgtcttgttttagagctcaaa |
112 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
40595111 |
ttttaaataatatcgctaacgaagtcctcgtgtcttgttttaaagctcaaa |
40595061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University