View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8793_low_31 (Length: 236)
Name: NF8793_low_31
Description: NF8793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8793_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 68 - 219
Target Start/End: Complemental strand, 1194646 - 1194495
Alignment:
| Q |
68 |
aatgaatcaaatcacaacatcattcacaagcctgacgatttgaatcaagaagtgcagaaattggaatacttccatcaacaaattgaaacttgttcttaac |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1194646 |
aatgaatcaaatcacaacatcattcacaagcctgactatttggatcaagaagtgcagaaattggaatacttccatcaacaaattgaaacttgttcttagc |
1194547 |
T |
|
| Q |
168 |
ccctaaagcacgacgaatggctcaagcccaagaaagatagttgcttttatct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1194546 |
ccctaaagcacgacgaatggctcaagcccaagaaagatagttgcttttatct |
1194495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 60 - 209
Target Start/End: Complemental strand, 4261261 - 4261112
Alignment:
| Q |
60 |
aatccaagaatgaatcaaatcacaacatcattcacaagcctgacgatttgaatcaagaagtgcagaaattggaatacttccatcaacaaattgaaacttg |
159 |
Q |
| |
|
|||||||||||||||||| | | ||||| ||| ||||||| |||||||| ||| ||||||||| || |||||| ||||||||||| || ||||||||| |
|
|
| T |
4261261 |
aatccaagaatgaatcaagttattacatcgttcccaagcctaacgatttggatcgagaagtgcaagaactggaatgcttccatcaacgaactgaaacttg |
4261162 |
T |
|
| Q |
160 |
ttcttaacccctaaagcacgacgaatggctcaagcccaagaaagatagtt |
209 |
Q |
| |
|
|||||| | ||||||||| ||||||| |||| |||||||| |||| |||| |
|
|
| T |
4261161 |
ttcttagcacctaaagcatgacgaatcgctcgagcccaagcaagaaagtt |
4261112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University