View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8793_low_33 (Length: 232)
Name: NF8793_low_33
Description: NF8793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8793_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 90 - 214
Target Start/End: Original strand, 11870369 - 11870496
Alignment:
| Q |
90 |
tgtaagaatgatcttgaagctgtgaggaatcagtacccattcgaaccactaaaggtacnnnnnnnnn---gtattatcatagttgatcttatgtagtgga |
186 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11870369 |
tgtaagaaagatcttgaagctgtgaggaatcagtacccattcgaaccactaaaggtactttattttttttgtattatcatagttgatcttatgtagtgga |
11870468 |
T |
|
| Q |
187 |
tttgttgttgttttttgtcatgctttat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
11870469 |
tttgttgttgttttttgtcatgctttat |
11870496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 20 - 92
Target Start/End: Original strand, 11870179 - 11870251
Alignment:
| Q |
20 |
tggtcttgatgctgaaatgtggattgactgccactatttcgaggtatatctgtcacactggctgattttgtgt |
92 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11870179 |
tggtcttgatgctgaaatgcggattgactgccactatttcgaggtatatctgtcacactggctgattttgtgt |
11870251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 90 - 146
Target Start/End: Original strand, 3104903 - 3104959
Alignment:
| Q |
90 |
tgtaagaatgatcttgaagctgtgaggaatcagtacccattcgaaccactaaaggta |
146 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| || ||||| ||||||||| |
|
|
| T |
3104903 |
tgtaagaaggatcttgaagctgtggcaaatcagtacccgtttgaacccctaaaggta |
3104959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University