View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8793_low_34 (Length: 231)
Name: NF8793_low_34
Description: NF8793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8793_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 15 - 214
Target Start/End: Complemental strand, 33411159 - 33410964
Alignment:
| Q |
15 |
attctaatcaagttagttagagtaatccattccagtgtgtgatcatttgtccagtgcagccatattgttattgtttttgaattttgagaattcacatagt |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33411159 |
attctaatcaagttagttagaggaatccattccagtgtgtgatcatttgtccagtgcagccatattgttattgtttttgaattttgagaattcacatagt |
33411060 |
T |
 |
| Q |
115 |
aggctttgctgaaaatcatgaatttagnnnnnnnnnnnnnnaaaggatttgtcaccacttctctaaatatataaataaaatatcacaaaatgtctgtttt |
214 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33411059 |
aggc-ttgctgaaaatcatgaatttag---tttttttttttaaaggatttgtcaccacttctctaaatatataaataaaatatcacaaaatgtctttttt |
33410964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University