View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8793_low_35 (Length: 226)

Name: NF8793_low_35
Description: NF8793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8793_low_35
NF8793_low_35
[»] chr7 (2 HSPs)
chr7 (148-208)||(43511626-43511686)
chr7 (19-99)||(43512252-43512330)
[»] chr2 (1 HSPs)
chr2 (56-101)||(41219212-41219257)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 148 - 208
Target Start/End: Complemental strand, 43511686 - 43511626
Alignment:
148 tttcaatctttttagggaaatgcggagcatcaatccttctacctctcgcatgctacaatct 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43511686 tttcaatctttttagggaaatgcggagcatcaatccttctacctctcgcatgctacaatct 43511626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 43512330 - 43512252
Alignment:
19 aatgatcttccaatttcggggagaatttacnnnnnnnctccgtttccatcaagaattgaatggagttttcctgtatctcga 99  Q
    ||||||||||||||||||||||||||||||       ||| ||||||||||||||||||||||||||||| ||||||||||    
43512330 aatgatcttccaatttcggggagaatttacaaaaa--ctctgtttccatcaagaattgaatggagttttcgtgtatctcga 43512252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 101
Target Start/End: Original strand, 41219212 - 41219257
Alignment:
56 ctccgtttccatcaagaattgaatggagttttcctgtatctcgaca 101  Q
    ||||||||||||| |||||| ||||||||||||| |||| ||||||    
41219212 ctccgtttccatcgagaattaaatggagttttcccgtatttcgaca 41219257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University