View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8793_low_35 (Length: 226)
Name: NF8793_low_35
Description: NF8793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8793_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 148 - 208
Target Start/End: Complemental strand, 43511686 - 43511626
Alignment:
| Q |
148 |
tttcaatctttttagggaaatgcggagcatcaatccttctacctctcgcatgctacaatct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43511686 |
tttcaatctttttagggaaatgcggagcatcaatccttctacctctcgcatgctacaatct |
43511626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 43512330 - 43512252
Alignment:
| Q |
19 |
aatgatcttccaatttcggggagaatttacnnnnnnnctccgtttccatcaagaattgaatggagttttcctgtatctcga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43512330 |
aatgatcttccaatttcggggagaatttacaaaaa--ctctgtttccatcaagaattgaatggagttttcgtgtatctcga |
43512252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 101
Target Start/End: Original strand, 41219212 - 41219257
Alignment:
| Q |
56 |
ctccgtttccatcaagaattgaatggagttttcctgtatctcgaca |
101 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| |||| |||||| |
|
|
| T |
41219212 |
ctccgtttccatcgagaattaaatggagttttcccgtatttcgaca |
41219257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University