View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8793_low_36 (Length: 223)
Name: NF8793_low_36
Description: NF8793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8793_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 17761500 - 17761696
Alignment:
| Q |
17 |
aattattgcagggggcatcgtaggaaacttaactcaaatgttctatagacatgatcctcctttttgaaaaattaatatgcaaaggagttttattatcaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17761500 |
aattattgcagggggcatcgtaggaaacttacctcaaatgttctatagacatgatcctcctttttgagaaattaatatgcaaaggagttttattatcaaa |
17761599 |
T |
|
| Q |
117 |
caaacgaaagaattgaactgnnnnnnnnacacaggtaaataagctttgaatctttcttggctttcctgactcattttatttcgagctcttatctctg |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17761600 |
caaacgaaagaattgaactgttttttttacacaggtaaataagctttgaatctttcttggctttcctgactcattttatttcgagctcttatctctg |
17761696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University