View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8793_low_4 (Length: 555)

Name: NF8793_low_4
Description: NF8793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8793_low_4
NF8793_low_4
[»] chr2 (16 HSPs)
chr2 (389-554)||(37485057-37485222)
chr2 (192-363)||(37485247-37485418)
chr2 (174-265)||(3989715-3989806)
chr2 (459-548)||(3989509-3989598)
chr2 (210-361)||(39679364-39679515)
chr2 (172-248)||(12364659-12364735)
chr2 (251-351)||(37253940-37254040)
chr2 (174-248)||(37314227-37314301)
chr2 (174-350)||(23292316-23292492)
chr2 (174-222)||(31901815-31901863)
chr2 (172-226)||(19262284-19262338)
chr2 (172-222)||(29523120-29523170)
chr2 (312-358)||(42346235-42346281)
chr2 (169-222)||(18541513-18541566)
chr2 (205-250)||(37254978-37255023)
chr2 (174-246)||(43868962-43869034)
[»] chr1 (16 HSPs)
chr1 (389-554)||(50323979-50324144)
chr1 (207-363)||(50324173-50324329)
chr1 (174-361)||(28235580-28235767)
chr1 (209-314)||(8257619-8257724)
chr1 (447-544)||(8257396-8257494)
chr1 (173-322)||(28282907-28283056)
chr1 (174-213)||(45484841-45484880)
chr1 (174-280)||(31985152-31985258)
chr1 (252-360)||(51727813-51727921)
chr1 (174-248)||(32364957-32365031)
chr1 (174-357)||(50656235-50656418)
chr1 (171-213)||(9294556-9294598)
chr1 (171-233)||(24639596-24639658)
chr1 (176-246)||(37670737-37670807)
chr1 (171-248)||(44258513-44258590)
chr1 (259-335)||(33690761-33690837)
[»] chr6 (6 HSPs)
chr6 (46-163)||(25370884-25371001)
chr6 (174-361)||(23596548-23596735)
chr6 (304-351)||(19762744-19762791)
chr6 (174-222)||(22350471-22350519)
chr6 (174-248)||(29291646-29291720)
chr6 (177-213)||(30427141-30427177)
[»] chr8 (8 HSPs)
chr8 (169-361)||(40484684-40484876)
chr8 (174-351)||(27844956-27845133)
chr8 (174-350)||(45218757-45218933)
chr8 (170-311)||(31892408-31892549)
chr8 (174-248)||(3656553-3656627)
chr8 (206-351)||(36834633-36834778)
chr8 (174-233)||(27678559-27678618)
chr8 (306-357)||(29868973-29869024)
[»] chr7 (11 HSPs)
chr7 (174-361)||(36098824-36099011)
chr7 (172-361)||(34190956-34191145)
chr7 (174-264)||(20130581-20130671)
chr7 (174-312)||(44605041-44605179)
chr7 (174-356)||(20623918-20624100)
chr7 (174-229)||(1583206-1583261)
chr7 (304-351)||(16561808-16561855)
chr7 (304-351)||(16603807-16603854)
chr7 (170-204)||(29984209-29984243)
chr7 (174-222)||(11733479-11733527)
chr7 (182-226)||(32009955-32009999)
[»] chr4 (7 HSPs)
chr4 (218-309)||(28358141-28358230)
chr4 (459-548)||(28358334-28358423)
chr4 (170-356)||(34856698-34856884)
chr4 (175-357)||(280966-281148)
chr4 (174-280)||(25511416-25511522)
chr4 (174-288)||(8260241-8260355)
chr4 (192-337)||(8133558-8133703)
[»] chr5 (6 HSPs)
chr5 (166-336)||(27193872-27194042)
chr5 (171-222)||(8760205-8760256)
chr5 (174-213)||(17643497-17643536)
chr5 (285-356)||(33224210-33224281)
chr5 (174-248)||(33898152-33898226)
chr5 (174-247)||(33224109-33224182)
[»] chr3 (11 HSPs)
chr3 (174-249)||(31482516-31482591)
chr3 (174-222)||(2848494-2848542)
chr3 (171-230)||(33635820-33635879)
chr3 (174-248)||(51536374-51536448)
chr3 (174-357)||(53612509-53612692)
chr3 (174-222)||(10258314-10258362)
chr3 (195-291)||(53724822-53724918)
chr3 (171-226)||(16056799-16056854)
chr3 (172-233)||(45103345-45103406)
chr3 (172-204)||(23241317-23241349)
chr3 (268-336)||(45159223-45159291)
[»] scaffold0332 (1 HSPs)
scaffold0332 (174-300)||(1645-1771)
[»] scaffold0036 (1 HSPs)
scaffold0036 (268-357)||(52601-52690)
[»] scaffold0131 (1 HSPs)
scaffold0131 (174-248)||(7197-7271)
[»] scaffold0070 (1 HSPs)
scaffold0070 (174-248)||(13415-13489)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 2e-81; HSPs: 16)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 389 - 554
Target Start/End: Complemental strand, 37485222 - 37485057
Alignment:
Q  389 ttagaagggatgtatgaaggcggtcatctctcaggcatcagctttcttcccaaaagctaaaatcgagtggtgacccattttttcaaacacatcactttgt 488  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37485222 ttagaagggatgtatgaaggcggtcatctctcaggcatcagctttcttcccaaaagctaaaatcgagtggtgacccattttttcaaacacatcactttgt 37485123  T
Q  489 tgttttaattacatagagttgaagaagatgatgagagaagtttagatccgttctttgtttcttcac 554  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||    
T  37485122 tgttttaattacatagagttgaaaaagatgatgagagaagtttagatctgttctttgtttattcac 37485057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 192 - 363
Target Start/End: Complemental strand, 37485418 - 37485247
Alignment:
Q  192 accggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcacttgaaccggtgaaaaccgg 291  Q
    |||||||||| || ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |    
T  37485418 accggaccggtcggtcggaccagtcagaccgggaaccggtggtatgtccggttcgagcagcttaatggattggctgtgcacttgaaccggtgaaaaccag 37485319  T
Q  292 tgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaatgcattg 363  Q
    ||||| ||||||||||| |||||||| |||||||||||| |||||| |||||||||||||||||||||||||    
T  37485318 tgtggttcggacaaaacaggtaaaaaccggcgactcggctggtttaatgaaccggaccggttcaatgcattg 37485247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 174 - 265
Target Start/End: Complemental strand, 3989806 - 3989715
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggc 265  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  3989806 catagttttaaaaaccggaccggaccggccggtcggaccggtcagaccgggaaccggtggtatgtccggttcgagcagcttaatggatcggc 3989715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 459 - 548
Target Start/End: Complemental strand, 3989598 - 3989509
Alignment:
Q  459 tgacccattttttcaaacacatcactttgttgttttaattacatagagttgaagaagatgatgagagaagtttagatccgttctttgttt 548  Q
    ||||||||||||||||| ||| ||||||||||| | ||||||||||| ||||||| |||||||||||||||||||||| |||||||||||    
T  3989598 tgacccattttttcaaatacaccactttgttgtctcaattacatagaattgaagaggatgatgagagaagtttagatctgttctttgttt 3989509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 210 - 361
Target Start/End: Complemental strand, 39679515 - 39679364
Alignment:
Q  210 accggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcacttgaaccggtgaaaaccggtgtggctcggacaaaacc 309  Q
    ||||||| ||||| ||| ||||||| || |||||||||||  |   |||||||||   |||| || | ||||| | |||||||||| ||||| ||||||     
T  39679515 accggtccgaccgtgaaccggtggtgtggccggttcgagctacaagatggatcggacatgcatttaacccggtaagaaccggtgtgactcggccaaaact 39679416  T
Q  310 ggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaatgcat 361  Q
    | | |||||||| |||||||||| ||| |||||||||||||| |||||||||    
T  39679415 gatcaaaatcggtgactcggccgatttggtgaaccggaccgggtcaatgcat 39679364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 172 - 248
Target Start/End: Original strand, 12364659 - 12364735
Alignment:
Q  172 atcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgag 248  Q
    ||||||||||||||| ||||  ||||||||||| | |||||||||  ||||| ||||||||||||| ||||||||||    
T  12364659 atcatagttttaaaacccggctcggaccggccggttggaccggtcgaaccggaaatcggtggtatggccggttcgag 12364735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 251 - 351
Target Start/End: Original strand, 37253940 - 37254040
Alignment:
Q  251 gcttaatggatcggctgtgcacttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccg 350  Q
    ||||| ||||||||   |||| |||||||||| ||||||||  || ||||   ||||||||||||||||||| |||||||||||||| ||||||| ||||    
T  37253940 gcttattggatcgggcatgcaattgaaccggtcaaaaccggcatgactcgctaaaaaccggtaaaaatcggccactcggccggtttaatgaaccgaaccg 37254039  T
Q  351 g 351  Q
    |    
T  37254040 g 37254040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 174 - 248
Target Start/End: Original strand, 37314227 - 37314301
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgag 248  Q
    ||||||||| ||||||||||||||||||||| | | ||||||| |||| |||| ||||||  || ||||||||||    
T  37314227 catagttttgaaaaccggaccggaccggccggttgaaccggtccgaccaggaaccggtggggtgaccggttcgag 37314301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 174 - 350
Target Start/End: Original strand, 23292316 - 23292492
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    |||||||||||||  |||||| ||||||||| || ||||| ||  |||| ||| ||| | | || ||||||||  | ||||| ||||||||   || | |    
T  23292316 catagttttaaaactcggacctgaccggccggtccgaccgatcgaaccgtgaaccggggatgtgaccggttcggtctgcttattggatcggagatgtagt 23292415  T
Q  274 tgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccg 350  Q
    |||||| || ||||| ||| || ||||   ||||||||| |||| ||| ||||||||||||||  ||||||||||||    
T  23292416 tgaaccagtcaaaactggtatgactcgctaaaaaccggtgaaaaccggtgactcggccggtttgatgaaccggaccg 23292492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 31901863 - 31901815
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccg 222  Q
    ||||||||| |||||||||||||| |||||| ||||||||||| |||||    
T  31901863 catagttttgaaaaccggaccggatcggccggtcggaccggtccgaccg 31901815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 172 - 226
Target Start/End: Original strand, 19262284 - 19262338
Alignment:
Q  172 atcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaa 226  Q
    |||||||||||||||| |||||||||||||||| |||  |||||| | |||||||    
T  19262284 atcatagttttaaaaatcggaccggaccggccggtcgagccggtccgcccgggaa 19262338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 172 - 222
Target Start/End: Original strand, 29523120 - 29523170
Alignment:
Q  172 atcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccg 222  Q
    ||||||||||| ||||||||||||||||||| | ||| ||||||| |||||    
T  29523120 atcatagttttgaaaaccggaccggaccggctggtcgaaccggtccgaccg 29523170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 312 - 358
Target Start/End: Complemental strand, 42346281 - 42346235
Alignment:
Q  312 taaaaatcggcgactcggccggtttagtgaaccggaccggttcaatg 358  Q
    |||||| ||| |||||||||||||| |||||||||||||| ||||||    
T  42346281 taaaaaccggtgactcggccggtttggtgaaccggaccgggtcaatg 42346235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 169 - 222
Target Start/End: Complemental strand, 18541566 - 18541513
Alignment:
Q  169 ttaatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccg 222  Q
    |||| ||||||||| ||||||||||||||||||||| ||| ||| ||| |||||    
T  18541566 ttaagcatagttttgaaaaccggaccggaccggccggtcgaaccagtccgaccg 18541513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 37254978 - 37255023
Alignment:
Q  205 atcggaccggtcagaccgggaatcggtggtatgtccggttcgagca 250  Q
    ||||||||||||  ||||||| | ||||||||||||||||||||||    
T  37254978 atcggaccggtctaaccgggacttggtggtatgtccggttcgagca 37255023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 174 - 246
Target Start/End: Original strand, 43868962 - 43869034
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcg 246  Q
    ||||||||||||||||||  ||||||||||| | |||||||||  | || ||| ||||||| |||||| ||||    
T  43868962 catagttttaaaaaccggctcggaccggccggttggaccggtcgaatcgtgaaccggtggtgtgtccgattcg 43869034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 150; Significance: 5e-79; HSPs: 16)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 5e-79
Query Start/End: Original strand, 389 - 554
Target Start/End: Complemental strand, 50324144 - 50323979
Alignment:
Q  389 ttagaagggatgtatgaaggcggtcatctctcaggcatcagctttcttcccaaaagctaaaatcgagtggtgacccattttttcaaacacatcactttgt 488  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50324144 ttagaagggatgtatgaaggcggtcatctctcaggcatcagctttcttcccaaaagctaaaatcgagtggtgacccattttttcaaacacatcactttgt 50324045  T
Q  489 tgttttaattacatagagttgaagaagatgatgagagaagtttagatccgttctttgtttcttcac 554  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||  ||||||||||| |||||    
T  50324044 tgttttaattacatagagttgaaaaagatgatgagagaagtttagatttgttctttgtttattcac 50323979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 133; E-Value: 7e-69
Query Start/End: Original strand, 207 - 363
Target Start/End: Complemental strand, 50324329 - 50324173
Alignment:
Q  207 cggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcacttgaaccggtgaaaaccggtgtggctcggacaaa 306  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  50324329 cggaccggtcagaccgggaatcggtggtatgttcggttcgagcagcttaatggatcggctgtgcacttgaaccggtgaaaaccggtgtggctcggataaa 50324230  T
Q  307 accggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaatgcattg 363  Q
    ||||||||||| || |||||||||||||||| |||||||||||| ||||||||||||    
T  50324229 accggtaaaaaccgacgactcggccggtttaatgaaccggaccgattcaatgcattg 50324173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 174 - 361
Target Start/End: Complemental strand, 28235767 - 28235580
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    ||||||||||||||||||||||||||||||| ||| ||||||| ||||| ||||||||||| || |||||||||||  | | |||||||||   |||| |    
T  28235767 catagttttaaaaaccggaccggaccggccggtcgaaccggtccgaccgtgaatcggtggtgtggccggttcgagctacatgatggatcggacatgcatt 28235668  T
Q  274 tgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaatgcat 361  Q
      | ||||||| |||||||||| ||||| |||||||||| |||||||| |||||||||||||| |||||||||||||| |||||||||    
T  28235667 caacccggtgagaaccggtgtgactcggccaaaaccggtcaaaatcggtgactcggccggtttggtgaaccggaccgggtcaatgcat 28235580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 209 - 314
Target Start/End: Complemental strand, 8257724 - 8257619
Alignment:
Q  209 gaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcacttgaaccggtgaaaaccggtgtggctcggacaaaac 308  Q
    |||| ||||||||||||| |||||||||||||| |||||||||||||||||||| | |||||| |||||||| |||||||||||||||||||||||||||    
T  8257724 gaccagtcagaccgggaaccggtggtatgtccgattcgagcagcttaatggatcagttgtgcatttgaaccgatgaaaaccggtgtggctcggacaaaac 8257625  T
Q  309 cggtaa 314  Q
    ||||||    
T  8257624 cggtaa 8257619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 447 - 544
Target Start/End: Complemental strand, 8257494 - 8257396
Alignment:
Q  447 aaaatcgagtgg-tgacccattttttcaaacacatcactttgttgttttaattacatagagttgaagaagatgatgagagaagtttagatccgttcttt 544  Q
    ||||| |||||| |||||||||||| |||| ||| ||||||||| | | ||||||||| | ||||||| |||||||||| ||||||||||| |||||||    
T  8257494 aaaatggagtggatgacccatttttccaaatacaccactttgttatctcaattacataaaattgaagaggatgatgagaaaagtttagatctgttcttt 8257396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 173 - 322
Target Start/End: Complemental strand, 28283056 - 28282907
Alignment:
Q  173 tcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcac 272  Q
    |||||||||||||| ||| |||||| |||||| || |||||||   |||| ||| |||||  ||| ||||||||  | ||||| ||||||||   ||||     
T  28283056 tcatagttttaaaacccgaaccggatcggccggtccgaccggtttaaccgtgaaccggtgacatgaccggttcggtctgcttattggatcgggcatgcaa 28282957  T
Q  273 ttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggc 322  Q
    |||||||||| ||||||||  || ||||   |||||||||||||||||||    
T  28282956 ttgaaccggtcaaaaccggcatgactcgctaaaaaccggtaaaaatcggc 28282907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 45484880 - 45484841
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccg 213  Q
    |||||||||||||||||||||||||||||||||| |||||    
T  45484880 catagttttaaaaaccggaccggaccggccgatcagaccg 45484841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 174 - 280
Target Start/End: Original strand, 31985152 - 31985258
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    |||||||||||||  |||||||||||||||| |||||||||||  ||| |||| ||||   ||| ||||||||||||| |   |||||||| | |||| |    
T  31985152 catagttttaaaactcggaccggaccggccggtcggaccggtccaaccaggaaccggtaacatgaccggttcgagcagatagttggatcggatatgcagt 31985251  T
Q  274 tgaaccg 280  Q
    |||||||    
T  31985252 tgaaccg 31985258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 252 - 360
Target Start/End: Complemental strand, 51727921 - 51727813
Alignment:
Q  252 cttaatggatcggctgtgcacttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcgg-ccggtttagtgaaccggaccg 350  Q
    |||||||||||||  ||||| |||||||||| | |||||| | | |||||  |||| || || ||| ||| ||||||| ||||||| |||||||||||||    
T  51727921 cttaatggatcggtcgtgcagttgaaccggtcagaaccggcgcgactcggggaaaatcg-tagaaaccggtgactcggaccggtttggtgaaccggaccg 51727823  T
Q  351 gttcaatgca 360  Q
    ||||||||||    
T  51727822 gttcaatgca 51727813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 248
Target Start/End: Complemental strand, 32365031 - 32364957
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtg-gtatgtccggttcgag 248  Q
    ||||||||||||||||||  ||||||||||| ||| ||||||| ||||| ||| ||||| ||| ||||||||||||    
T  32365031 catagttttaaaaaccggctcggaccggccggtcgaaccggtccgaccgtgaaccggtgtgta-gtccggttcgag 32364957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 357
Target Start/End: Complemental strand, 50656418 - 50656235
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    |||||||||||||  |||||||| ||||||| |  ||||| ||  |||| ||| ||| | | || ||||||||  | ||||| ||||||||   || | |    
T  50656418 catagttttaaaactcggaccggcccggccggttcgaccgatcgaaccgtgaaccggggatgtgaccggttcggtctgcttattggatcggagatgtagt 50656319  T
Q  274 tgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaat 357  Q
    |||||| || ||||||||| || ||||   ||||||||| |||| ||| |||||||| |||||  ||||||||||||| |||||    
T  50656318 tgaaccagtcaaaaccggtatgactcgctaaaaaccggtgaaaaccggtgactcggcaggtttgatgaaccggaccgggtcaat 50656235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 9294598 - 9294556
Alignment:
Q  171 aatcatagttttaaaaaccggaccggaccggccgatcggaccg 213  Q
    |||||||||||| ||||||||||||||||||||| || |||||    
T  9294598 aatcatagttttgaaaaccggaccggaccggccggtccgaccg 9294556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 24639658 - 24639596
Alignment:
Q  171 aatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtgg 233  Q
    |||||||||||||||||||||  ||||||||||| ||| |||||||  ||| |||| ||||||    
T  24639658 aatcatagttttaaaaaccggctcggaccggccggtcgaaccggtccaacctggaaccggtgg 24639596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 176 - 246
Target Start/End: Complemental strand, 37670807 - 37670737
Alignment:
Q  176 tagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcg 246  Q
    |||||||||||||| |  |  ||||||||||||||||||||  |||| ||| ||||||| |||||||||||    
T  37670807 tagttttaaaaaccagctcaaaccggccgatcggaccggtcgaaccgtgaaccggtggtgtgtccggttcg 37670737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 171 - 248
Target Start/End: Complemental strand, 44258590 - 44258513
Alignment:
Q  171 aatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgag 248  Q
    |||||||||||| |||| |||||||||||| ||| | | ||||||| |||| |||| ||||||  || ||||||||||    
T  44258590 aatcatagttttgaaaatcggaccggaccgtccggttgaaccggtccgaccaggaaccggtggggtgaccggttcgag 44258513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 259 - 335
Target Start/End: Complemental strand, 33690837 - 33690761
Alignment:
Q  259 gatcggctgtgcacttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtt 335  Q
    |||||||  |||| ||||| ||||| ||||||||| | |||| | ||||||||| |||| ||| |||||||||||||    
T  33690837 gatcggccatgcaattgaatcggtgtaaaccggtgagactcgtataaaaccggtcaaaaccggtgactcggccggtt 33690761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 90; Significance: 3e-43; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 46 - 163
Target Start/End: Original strand, 25370884 - 25371001
Alignment:
Q  46 tgttgtatcgtctattatcttgatcatggttggtatcattacactaaatagcgtcacaactattgagaaaagagtttacatggtaaaggcattgacaaaa 145  Q
    |||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |||||    
T  25370884 tgttgtatcgtctattatcttgattatggttggtattattacactaaatagcgttacaactattgagtaaagagtttacatggtaaaggcattggcaaaa 25370983  T
Q  146 gatgtgtggcctcatcta 163  Q
      ||||||||||||||||    
T  25370984 tgtgtgtggcctcatcta 25371001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 174 - 361
Target Start/End: Complemental strand, 23596735 - 23596548
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    ||||||||| |||||| ||||||||||| || ||| ||||||| |||||  |||||||| | || |||||||||||| | |  ||||||||   |||| |    
T  23596735 catagtttttaaaaccagaccggaccggacggtcgaaccggtccgaccgtaaatcggtgatgtggccggttcgagcaacatgttggatcggacatgcatt 23596636  T
Q  274 tgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaatgcat 361  Q
    | |||||| || ||||||| | |||||||||||||||||||||| ||| ||||| |||||||| |||||||||||||| |||||||||    
T  23596635 taaaccggagagaaccggtatagctcggacaaaaccggtaaaaaccggtgactcagccggtttggtgaaccggaccgggtcaatgcat 23596548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 304 - 351
Target Start/End: Original strand, 19762744 - 19762791
Alignment:
Q  304 aaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccgg 351  Q
    ||||||||||||||||||| |||||||||||||| ||||||| |||||    
T  19762744 aaaaccggtaaaaatcggccactcggccggtttaatgaaccgaaccgg 19762791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 174 - 222
Target Start/End: Original strand, 22350471 - 22350519
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccg 222  Q
    ||||||||| ||||||||||||||||||||| ||| ||||||| |||||    
T  22350471 catagttttgaaaaccggaccggaccggccggtcgaaccggtccgaccg 22350519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 174 - 248
Target Start/End: Original strand, 29291646 - 29291720
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgag 248  Q
    |||||||||||||  |||||||||||||||| | | |||| ||||| || ||| ||||| |||||| ||||||||    
T  29291646 catagttttaaaactcggaccggaccggccggttgaaccgatcagatcgtgaaccggtgatatgtctggttcgag 29291720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 177 - 213
Target Start/End: Complemental strand, 30427177 - 30427141
Alignment:
Q  177 agttttaaaaaccggaccggaccggccgatcggaccg 213  Q
    |||||||||||||||| ||||||||||| ||||||||    
T  30427177 agttttaaaaaccggatcggaccggccggtcggaccg 30427141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 89; Significance: 1e-42; HSPs: 8)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 169 - 361
Target Start/End: Original strand, 40484684 - 40484876
Alignment:
Q  169 ttaatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgt 268  Q
    |||| ||||||||||||||||||||||||||||||| ||| ||||||| ||||| ||| ||||||| || |||||||||||  | | |||||||||   |    
T  40484684 ttaagcatagttttaaaaaccggaccggaccggccggtcgaaccggtccgaccgtgaaccggtggtgtggccggttcgagctacatgatggatcggacat 40484783  T
Q  269 gcacttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaatgcat 361  Q
    ||| |  | ||||||| |||||||||| ||||| |||||||||| |||||||| |||||||||||||| |||||||||||||| |||||||||    
T  40484784 gcattcaacccggtgagaaccggtgtgactcggccaaaaccggtcaaaatcggtgactcggccggtttggtgaaccggaccgggtcaatgcat 40484876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 174 - 351
Target Start/End: Original strand, 27844956 - 27845133
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    ||||||||||||| ||||||||||||||||| || || ||||   ||||  || ||||| |||| |||||| |  | | ||| ||||||||   |||| |    
T  27844956 catagttttaaaacccggaccggaccggccggtccgaacggttgaaccgtaaaccggtgatatgaccggtttggtctgtttattggatcggacatgcaat 27845055  T
Q  274 tgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccgg 351  Q
    ||||||||| ||||||||  || ||||   ||||||||||||||||||| |||| ||||||||| ||||||| |||||    
T  27845056 tgaaccggtcaaaaccggcatgactcgttaaaaaccggtaaaaatcggccactcagccggtttaatgaaccgaaccgg 27845133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 174 - 350
Target Start/End: Original strand, 45218757 - 45218933
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    ||||||||||||| ||||  |||||||| || || |||||||   |||| ||| ||||||| | || ||||||| |  |||| |||||||| |||||| |    
T  45218757 catagttttaaaacccggctcggaccggacggtccgaccggttgaaccgtgaaccggtggtgtatctggttcgatctacttattggatcggttgtgcagt 45218856  T
Q  274 tgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccg 350  Q
    ||||||||||| |||||| ||| ||||    ||  |||||||| |||| ||||| |||||||| |||||||||||||    
T  45218857 tgaaccggtgagaaccggcgtgactcgcttgaactcggtaaaactcggtgactcagccggtttggtgaaccggaccg 45218933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 170 - 311
Target Start/End: Original strand, 31892408 - 31892549
Alignment:
Q  170 taatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtg 269  Q
    ||||||||||||||||| ||||  ||| ||||||| || |||| ||  ||||  ||| |||||||||  ||||||||| | | ||| ||||||||  |||    
T  31892408 taatcatagttttaaaacccggctcgggccggccggtccgaccagttggaccatgaaccggtggtataaccggttcgaactgattattggatcggtcgtg 31892507  T
Q  270 cacttgaaccggtgaaaaccggtgtggctcggacaaaaccgg 311  Q
     | |||||||||| ||||||||| ||||||||  ||||||||    
T  31892508 taattgaaccggttaaaaccggtatggctcggtaaaaaccgg 31892549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 174 - 248
Target Start/End: Complemental strand, 3656627 - 3656553
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgag 248  Q
    ||||||||| ||||| ||||||||||||||| | | ||||||| ||||| ||| |||||| ||| ||||||||||    
T  3656627 catagttttgaaaactggaccggaccggccggttgaaccggtccgaccgtgaaccggtgggatgaccggttcgag 3656553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 206 - 351
Target Start/End: Complemental strand, 36834778 - 36834633
Alignment:
Q  206 tcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcacttgaaccggtgaaaaccggtgtggctcggacaa 305  Q
    ||||||||||   ||| |||| |||||||||  ||||||||||||||    ||||||||   || | |||||||||||  ||||||| |  || ||| ||    
T  36834778 tcggaccggttgaaccaggaaccggtggtatagccggttcgagcagcaagttggatcggtcatgtaattgaaccggtgtgaaccggtataacttggaaaa 36834679  T
Q  306 aaccggtaaaaatcggcgactcggccggtttagtgaaccggaccgg 351  Q
    || |||| |||| |||  ||||||||||||||||||||||||||||    
T  36834678 aatcggtgaaaaccggtaactcggccggtttagtgaaccggaccgg 36834633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 233
Target Start/End: Original strand, 27678559 - 27678618
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtgg 233  Q
    ||||||||| ||||||||||||||||||||| | | ||||||| |||| |||| ||||||    
T  27678559 catagttttgaaaaccggaccggaccggccggttgaaccggtccgaccaggaaccggtgg 27678618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 357
Target Start/End: Complemental strand, 29869024 - 29868973
Alignment:
Q  306 aaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaat 357  Q
    |||||||||||| ||| |||||||||||||| |||| ||||||||| |||||    
T  29869024 aaccggtaaaaaccggtgactcggccggtttggtgagccggaccgggtcaat 29868973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 88; Significance: 5e-42; HSPs: 11)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 174 - 361
Target Start/End: Original strand, 36098824 - 36099011
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    ||||||||||||||||||||||||||||||| ||| ||||||| ||||| ||| ||||||| || |||||||||||  | | |||||||||   |||| |    
T  36098824 catagttttaaaaaccggaccggaccggccggtcgaaccggtccgaccgtgaaccggtggtgtggccggttcgagctacatgatggatcggacatgcatt 36098923  T
Q  274 tgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaatgcat 361  Q
      | ||||||| |||||||||| ||||| |||||||||| |||||||| |||||||||||||| |||||||||||||| |||||||||    
T  36098924 caacccggtgagaaccggtgtgactcggccaaaaccggtcaaaatcggtgactcggccggtttggtgaaccggaccgggtcaatgcat 36099011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 172 - 361
Target Start/End: Original strand, 34190956 - 34191145
Alignment:
Q  172 atcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgca 271  Q
    |||||||||||||||||| |||||||||||||| ||| |||| || |||||  |||||||| | || |||||||||||| | |  ||||||||   ||||    
T  34190956 atcatagttttaaaaaccagaccggaccggccggtcgaaccgatccgaccgtaaatcggtgatgtggccggttcgagcaacatgttggatcggacatgca 34191055  T
Q  272 cttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaatgcat 361  Q
     || |||||| || |||| || |||||||||||||||||||||||| ||| ||||| |||||||| |||||||||||||| |||||||||    
T  34191056 tttaaaccggagagaaccagtatggctcggacaaaaccggtaaaaaccggtgactcagccggtttggtgaaccggaccgggtcaatgcat 34191145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 174 - 264
Target Start/End: Original strand, 20130581 - 20130671
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcgg 264  Q
    |||||||||||||| |||| ||||||||||| | | ||||||||||||||||| | ||| |||||||||||||||| | | ||||||||||    
T  20130581 catagttttaaaaatcggatcggaccggccggttgaaccggtcagaccgggaaccagtgctatgtccggttcgagctgataaatggatcgg 20130671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 174 - 312
Target Start/End: Original strand, 44605041 - 44605179
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatg-gatcggctgtgcac 272  Q
    |||||||||||||  |||  ||||||||||| || |||||||  ||| | ||| | |||||||| ||||||||| | | |||||  |||||||||||||     
T  44605041 catagttttaaaactcggctcggaccggccggtccgaccggttggacagtgaaccagtggtatgaccggttcgaactg-ttaatcagatcggctgtgcaa 44605139  T
Q  273 ttgaaccggtgaaaaccggtgtggctcggacaaaaccggt 312  Q
    |||||||||| |||||||| |||||||||| |||||||||    
T  44605140 ttgaaccggttaaaaccggcgtggctcggaaaaaaccggt 44605179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 174 - 356
Target Start/End: Complemental strand, 20624100 - 20623918
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    ||||||||| ||||||||| ||||||||||| | | ||||||| ||||  ||| ||||||  |||||||||| | |   ||| |||||||||  |||| |    
T  20624100 catagtttttaaaaccggatcggaccggccggttgaaccggtcggaccatgaaccggtggggtgtccggttcaatctatttattggatcggccatgcaat 20624001  T
Q  274 tgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaa 356  Q
      |||||||| ||||||   ||||||||   ||||||||||||| ||| || ||||||||||||   ||||||||||||||||    
T  20624000 caaaccggtgtaaaccgacatggctcggcggaaaccggtaaaaaccggtgaatcggccggtttacaaaaccggaccggttcaa 20623918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 229
Target Start/End: Complemental strand, 1583261 - 1583206
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcg 229  Q
    |||||||||||||| |||||||||||||||| | | ||||||| || |||||||||    
T  1583261 catagttttaaaaatcggaccggaccggccggttgaaccggtcggatcgggaatcg 1583206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 304 - 351
Target Start/End: Complemental strand, 16561855 - 16561808
Alignment:
Q  304 aaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccgg 351  Q
    |||| |||||||||||||| |||||||||||||| ||||||| |||||    
T  16561855 aaaatcggtaaaaatcggccactcggccggtttaatgaaccgaaccgg 16561808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 304 - 351
Target Start/End: Original strand, 16603807 - 16603854
Alignment:
Q  304 aaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccgg 351  Q
    |||| |||||||||||||| |||||||||||||| ||||||| |||||    
T  16603807 aaaatcggtaaaaatcggccactcggccggtttaatgaaccgaaccgg 16603854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 170 - 204
Target Start/End: Complemental strand, 29984243 - 29984209
Alignment:
Q  170 taatcatagttttaaaaaccggaccggaccggccg 204  Q
    ||||||||||||| |||||||||||||||||||||    
T  29984243 taatcatagttttgaaaaccggaccggaccggccg 29984209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 174 - 222
Target Start/End: Original strand, 11733479 - 11733527
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccg 222  Q
    ||||||||| |||||||||||||||||| || ||| ||||||| |||||    
T  11733479 catagttttgaaaaccggaccggaccggtcggtcgaaccggtccgaccg 11733527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 182 - 226
Target Start/End: Complemental strand, 32009999 - 32009955
Alignment:
Q  182 taaaaaccggaccggaccggccgatcggaccggtcagaccgggaa 226  Q
    ||||||||| ||||||||||||| |||||||||||  ||||||||    
T  32009999 taaaaaccgaaccggaccggccggtcggaccggtcgaaccgggaa 32009955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 57; Significance: 2e-23; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 218 - 309
Target Start/End: Original strand, 28358141 - 28358230
Alignment:
Q  218 gaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcacttgaaccggtgaaaaccggtgtggctcggacaaaacc 309  Q
    ||||||||| ||||||||||||||||||||||||||||||||||  |||||||| |||||||||||||||||  ||||||| ||| ||||||    
T  28358141 gaccgggaaccggtggtatgtccggttcgagcagcttaatggat--gctgtgcaattgaaccggtgaaaaccaatgtggcttggataaaacc 28358230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 459 - 548
Target Start/End: Original strand, 28358334 - 28358423
Alignment:
Q  459 tgacccattttttcaaacacatcactttgttgttttaattacatagagttgaagaagatgatgagagaagtttagatccgttctttgttt 548  Q
    |||||||||||| |||| ||| ||||||||||| | ||||||||||| ||||||| |||||||||||||||||| ||| |||||||||||    
T  28358334 tgacccatttttccaaatacaccactttgttgtctcaattacatagaattgaagaggatgatgagagaagtttaaatctgttctttgttt 28358423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 170 - 356
Target Start/End: Complemental strand, 34856884 - 34856698
Alignment:
Q  170 taatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtg 269  Q
    ||||||||||||| ||||||||  ||||||||||| | | |||| || ||||  ||| ||||||  |||||||||||| |   ||| |||||||||  ||    
T  34856884 taatcatagtttttaaaaccggctcggaccggccggttgaaccgatcggaccatgaaccggtggggtgtccggttcgatctatttattggatcggccatg 34856785  T
Q  270 cacttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaa 356  Q
    || |  |||||||| ||||||| |||||||||   ||||||||||||| ||| || ||||||||||||   ||||||||||||||||    
T  34856784 caatcaaaccggtgtaaaccggcgtggctcggcggaaaccggtaaaaaccggtgaatcggccggtttacaaaaccggaccggttcaa 34856698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 175 - 357
Target Start/End: Original strand, 280966 - 281148
Alignment:
Q  175 atagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcactt 274  Q
    |||||||||||||||||  ||||||||||| | || ||||||  | || ||| ||||||| |||||| ||||  | | |   |||||||| |||||| ||    
T  280966 atagttttaaaaaccggctcggaccggccggttgggccggtcgaatcgtgaaccggtggtgtgtccgattcggtctgatatttggatcggttgtgcagtt 281065  T
Q  275 gaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaat 357  Q
    ||| |||| | |||||| ||| ||||   |||  ||| | ||||||| |||||||||||||||| |||||||| ||| |||||    
T  281066 gaatcggtcagaaccggcgtgactcgctaaaactcggaataaatcggtgactcggccggtttagcgaaccggagcgggtcaat 281148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 174 - 280
Target Start/End: Complemental strand, 25511522 - 25511416
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    |||||||||||||  |||||||||||||||| |||||||||||  ||| |||| ||||   ||| ||||||||||||| |   |||||||| | |||| |    
T  25511522 catagttttaaaactcggaccggaccggccggtcggaccggtccaaccaggaaccggtaacatgaccggttcgagcagatagttggatcggatatgcaat 25511423  T
Q  274 tgaaccg 280  Q
    |||||||    
T  25511422 tgaaccg 25511416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 174 - 288
Target Start/End: Original strand, 8260241 - 8260355
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    ||||||||||||||||||   ||| |||||| ||||||||||   |||| ||| |||| |  |||||||||||  | || || |||||||||| |||| |    
T  8260241 catagttttaaaaaccggcttggatcggccggtcggaccggttcaaccgagaaccggtagggtgtccggttcggtctgcatattggatcggctatgcagt 8260340  T
Q  274 tgaaccggtgaaaac 288  Q
    | |||||||||||||    
T  8260341 taaaccggtgaaaac 8260355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 192 - 337
Target Start/End: Complemental strand, 8133703 - 8133558
Alignment:
Q  192 accggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcacttgaaccggtgaaaaccgg 291  Q
    |||||||||| || | ||||||||   |||| ||| ||||||| ||||| || ||   ||||||||||||||| | || | ||| ||||||| |||||||    
T  8133703 accggaccggacggttggaccggttgaaccgtgaaccggtggtgtgtccagtccggttagcttaatggatcggttatgtaattggaccggtggaaaccgg 8133604  T
Q  292 tgtggctcggacaaaaccggtaaaaatcggcgactcggccggttta 337  Q
      || |||||  ||||||||  |||| ||| |||||||||||||||    
T  8133603 aatgactcggttaaaaccggccaaaaccggtgactcggccggttta 8133558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 4e-18; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 166 - 336
Target Start/End: Original strand, 27193872 - 27194042
Alignment:
Q  166 atcttaatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatg-gatcgg 264  Q
    ||||||| |||||||||||||  |||  |||||||| || || |||||||  ||||| ||| | |||||||| ||||||||| | | |||||  ||||||    
T  27193872 atcttaaccatagttttaaaactcggctcggaccggtcggtccgaccggttggaccgcgaaccagtggtatgaccggttcgaactg-ttaatcagatcgg 27193970  T
Q  265 ctgtgcacttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggttt 336  Q
    ||||||| |||||||||| |||||||  |||||||||| |||| ||||  ||| ||| ||||||||||||||    
T  27193971 ctgtgcaattgaaccggttaaaaccgacgtggctcggaaaaaatcggtggaaaccggtgactcggccggttt 27194042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 171 - 222
Target Start/End: Original strand, 8760205 - 8760256
Alignment:
Q  171 aatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccg 222  Q
    |||||||||||| |||||||||||||| |||||| ||| ||||||| |||||    
T  8760205 aatcatagttttgaaaaccggaccggatcggccggtcgaaccggtccgaccg 8760256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 17643497 - 17643536
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccg 213  Q
    ||||||||||||||||||||||||||||||| || |||||    
T  17643497 catagttttaaaaaccggaccggaccggccggtccgaccg 17643536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 285 - 356
Target Start/End: Original strand, 33224210 - 33224281
Alignment:
Q  285 aaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaa 356  Q
    ||||||| |||||||||   ||||||||||||| ||| || ||||||||||||   ||||||||||||||||    
T  33224210 aaaccggcgtggctcggcggaaaccggtaaaaaccggtgaatcggccggtttacaaaaccggaccggttcaa 33224281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 174 - 248
Target Start/End: Original strand, 33898152 - 33898226
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgag 248  Q
    ||||||||| |||||||||||| |||||||| | ||||||||| |||| |||| || |||  || ||||||||||    
T  33898152 catagttttgaaaaccggaccgaaccggccggttggaccggtccgacctggaaccgatggggtggccggttcgag 33898226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 33224109 - 33224182
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcga 247  Q
    ||||||||| ||||||||| ||||||||||| | | ||||||| ||||  ||| ||||||  ||||||||||||    
T  33224109 catagtttttaaaaccggatcggaccggccggttgaaccggtcggaccatgaaccggtggggtgtccggttcga 33224182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 9e-16; HSPs: 11)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 174 - 249
Target Start/End: Original strand, 31482516 - 31482591
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagc 249  Q
    |||||||||||||| |||  |||||||| || |||||||||||  ||||||| |||||||||||||||||||||||    
T  31482516 catagttttaaaaatcgggtcggaccggacggtcggaccggtccaaccgggactcggtggtatgtccggttcgagc 31482591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 174 - 222
Target Start/End: Original strand, 2848494 - 2848542
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccg 222  Q
    ||||||||||||||||||||||||||||||| ||| ||||||| |||||    
T  2848494 catagttttaaaaaccggaccggaccggccggtcgaaccggtccgaccg 2848542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 171 - 230
Target Start/End: Complemental strand, 33635879 - 33635820
Alignment:
Q  171 aatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcgg 230  Q
    |||||||||||| |||||||||||||| |||||| ||| ||||||| ||||| |||||||    
T  33635879 aatcatagttttgaaaaccggaccggatcggccggtcgaaccggtccgaccgtgaatcgg 33635820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 248
Target Start/End: Original strand, 51536374 - 51536448
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtg-gtatgtccggttcgag 248  Q
    ||||||||||||||||||| ||||||||||| ||| ||||||| ||||| ||| ||||| ||| ||||||||||||    
T  51536374 catagttttaaaaaccggatcggaccggccggtcgaaccggtccgaccgtgaaccggtgtgta-gtccggttcgag 51536448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 357
Target Start/End: Complemental strand, 53612692 - 53612509
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    |||||||||||||  ||||||||| |||||| ||| ||||||| ||| | ||| ||  || ||| ||||||||  | || || | ||| || |||||| |    
T  53612692 catagttttaaaattcggaccggatcggccggtcgaaccggtcggactgcgaaccgaagggatgaccggttcggtctgcctattagattggttgtgcagt 53612593  T
Q  274 tgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaat 357  Q
    ||||||||| | |||||| ||  ||||   |||| || |  ||| ||| |||||||||||||| ||||||||||||||||||||    
T  53612592 tgaaccggtcagaaccggcgtaactcgataaaaatcgttggaaaccggtgactcggccggtttggtgaaccggaccggttcaat 53612509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 174 - 222
Target Start/End: Original strand, 10258314 - 10258362
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccg 222  Q
    ||||||||| ||||||||||||||||||||||||| ||| ||| |||||    
T  10258314 catagttttgaaaaccggaccggaccggccgatcgaaccagtcggaccg 10258362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 195 - 291
Target Start/End: Complemental strand, 53724918 - 53724822
Alignment:
Q  195 ggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcacttgaaccggtgaaaaccgg 291  Q
    ||||||| |||||||||||||  || || ||| ||||||| |||||||| | | ||  |||||||||||| | || | |||||||||||||||||||    
T  53724918 ggaccggtcgatcggaccggttggatcgtgaaccggtggtgtgtccggtcctaacaatttaatggatcggttatgtaattgaaccggtgaaaaccgg 53724822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 171 - 226
Target Start/End: Original strand, 16056799 - 16056854
Alignment:
Q  171 aatcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaa 226  Q
    |||||||||||||||||||||  ||||||||| | ||| ||||||| |||||||||    
T  16056799 aatcatagttttaaaaaccggctcggaccggctggtcgaaccggtccgaccgggaa 16056854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 172 - 233
Target Start/End: Original strand, 45103345 - 45103406
Alignment:
Q  172 atcatagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtgg 233  Q
    |||||| ||||||||  |||||||||||||||||||| ||||||  ||||| ||| ||||||    
T  45103345 atcataattttaaaactcggaccggaccggccgatcgaaccggttcgaccgtgaaccggtgg 45103406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 172 - 204
Target Start/End: Original strand, 23241317 - 23241349
Alignment:
Q  172 atcatagttttaaaaaccggaccggaccggccg 204  Q
    ||||||||||| |||||||||||||||||||||    
T  23241317 atcatagttttgaaaaccggaccggaccggccg 23241349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 45159291 - 45159223
Alignment:
Q  268 tgcacttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggttt 336  Q
    |||| |||||||||| ||||||||  ||||| ||  |||||||||  ||||||| ||||||||||||||    
T  45159291 tgcaattgaaccggttaaaaccggcttggcttggtaaaaaccggtggaaatcggtgactcggccggttt 45159223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0332 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0332
Description:

Target: scaffold0332; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 174 - 300
Target Start/End: Original strand, 1645 - 1771
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgagcagcttaatggatcggctgtgcact 273  Q
    ||||||||||||||||||  |||||| |||| || |||||||   |||| ||| ||||||| ||||| |||||| |  |||  |||||||| |||||| |    
T  1645 catagttttaaaaaccggttcggacctgccggtcagaccggttgaaccgtgaaccggtggtgtgtccagttcgatctacttgttggatcggttgtgcagt 1744  T
Q  274 tgaaccggtgaaaaccggtgtggctcg 300  Q
     |||||||||| |||||| ||| ||||    
T  1745 cgaaccggtgagaaccggcgtgactcg 1771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 268 - 357
Target Start/End: Complemental strand, 52690 - 52601
Alignment:
Q  268 tgcacttgaaccggtgaaaaccggtgtggctcggacaaaaccggtaaaaatcggcgactcggccggtttagtgaaccggaccggttcaat 357  Q
    |||| ||||||||||| ||||||| ||| |||||   ||||||||||||| ||| || |||||||||||   |||||||| |||||||||    
T  52690 tgcaattgaaccggtgtaaaccggcgtgactcggcggaaaccggtaaaaaccggtgaatcggccggttttcagaaccggagcggttcaat 52601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0131 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0131
Description:

Target: scaffold0131; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 174 - 248
Target Start/End: Original strand, 7197 - 7271
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgag 248  Q
    |||||||||||||  |||||||||||| ||| | | ||| ||| ||||| ||| ||||| |||||||||||||||    
T  7197 catagttttaaaactcggaccggaccgtccggttgaacccgtcggaccgtgaaccggtgatatgtccggttcgag 7271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0070 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0070
Description:

Target: scaffold0070; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 174 - 248
Target Start/End: Complemental strand, 13489 - 13415
Alignment:
Q  174 catagttttaaaaaccggaccggaccggccgatcggaccggtcagaccgggaatcggtggtatgtccggttcgag 248  Q
    ||||||||| |||||||||||| |||||||| | | ||||||| |||| |||| ||||||  || ||||||||||    
T  13489 catagttttgaaaaccggaccgaaccggccggttgaaccggtccgaccaggaagcggtggggtgaccggttcgag 13415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University