View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8794_low_9 (Length: 206)
Name: NF8794_low_9
Description: NF8794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8794_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 114 - 189
Target Start/End: Original strand, 4028098 - 4028173
Alignment:
| Q |
114 |
ggcaaagtagtcctctgtctcttttccctttccatcacaacttttcttcttcaagatctaccaattagatgtgatt |
189 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
4028098 |
ggcaaagtagtcctctatctcttttctctttccatcacaacttttcttcttcaaaatctatcaaagagatgtgatt |
4028173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 65 - 105
Target Start/End: Original strand, 4028038 - 4028078
Alignment:
| Q |
65 |
gcaagttaaatcaagaattatcgatacatgttatatactac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4028038 |
gcaagttaaatcaagaattatcgatacatgttatatactac |
4028078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University