View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8795_high_7 (Length: 257)
Name: NF8795_high_7
Description: NF8795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8795_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 43910076 - 43910282
Alignment:
| Q |
1 |
attaatgggcctaatagacctaaaagtggtgtcaagggttttaagaatgaaagagttaagtgaacaacaattgcattggtgtgnnnnnnngatgagcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43910076 |
attaatgggcctaatagacctaaaagtggtgtcaagggttttaagaatgaaagagttaagtgaacaacaattgcattggtgtgaaaaaaaaatgagcaaa |
43910175 |
T |
 |
| Q |
101 |
gtgagagttgtggaagggaaactttgtagagattattcaactccacttttcttcccctcacgttgattgaacaatcactttgtattatttgatgactgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43910176 |
gtgagagttgtggaagggaaactttgtagagattattcaactccacttttcttcccctcaagttgattgaacaatcactttgtattatttgatgactgga |
43910275 |
T |
 |
| Q |
201 |
ttatgtg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
43910276 |
ttatgtg |
43910282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University