View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8795_high_8 (Length: 237)
Name: NF8795_high_8
Description: NF8795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8795_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 219
Target Start/End: Original strand, 42623422 - 42623631
Alignment:
| Q |
10 |
agaagcagagaagaagtcggggcatggtaattcgtctttagaggcgccgcgacaaatggcagcccaagtagtttggaagagactgccggaacaaccgtcg |
109 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42623422 |
agaagcagaaaagaagtcggggcatggtaattcatctttagaggtgccgcgacaaatggcagcccaaatagtttggaagagactgccggaacaaccgtcg |
42623521 |
T |
 |
| Q |
110 |
aggagggtatggagattgcaagtacctatagctattccaccacaattgaatatattaacttgtacaagtacttgtggtaaatctttttcttcatttgagt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42623522 |
aggagggtatggagattgcaagtacctatagctattccaccacaattgaatatattaacttgtacaagtacttgtggtaaatctttttcttcatttgagt |
42623621 |
T |
 |
| Q |
210 |
gcatcttatt |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
42623622 |
gcatcttatt |
42623631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University