View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8795_low_4 (Length: 349)
Name: NF8795_low_4
Description: NF8795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8795_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 330
Target Start/End: Complemental strand, 36051118 - 36051010
Alignment:
| Q |
222 |
tttcatcatctaacaccggcaaaagatgccgccattcgggcttgaagtgccataagagatcagtggtaaaggtgtcccaatttgattgcggatgacggtg |
321 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
36051118 |
tttcttcatctaacacaggcaagagatgccgccattcaggcttaaagcgccataagagatcagtggtaaaggtgtcccaatttgactgcggatgacggcg |
36051019 |
T |
|
| Q |
322 |
agaccacca |
330 |
Q |
| |
|
||||||||| |
|
|
| T |
36051018 |
agaccacca |
36051010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 331
Target Start/End: Complemental strand, 44762419 - 44762303
Alignment:
| Q |
215 |
tcctctatttcatcatctaacaccggcaaaagatgccgccattcgggcttgaagtgccataagagatcagtggtaaaggtgtcccaatttgattgcggat |
314 |
Q |
| |
|
|||||| |||| || ||||||||||| || ||||| |||||||| ||||||| |||| || ||| |||||||||| ||||||||||| ||| | | | |
|
|
| T |
44762419 |
tcctctgtttcctcctctaacaccggtaagagatgacgccattcatgcttgaaacgccacaaaagagcagtggtaaaagtgtcccaattggatcgtgagt |
44762320 |
T |
|
| Q |
315 |
gacggtgagaccaccat |
331 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44762319 |
gacggtgagaccaccat |
44762303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 251 - 330
Target Start/End: Complemental strand, 30453113 - 30453034
Alignment:
| Q |
251 |
cgccattcgggcttgaagtgccataagagatcagtggtaaaggtgtcccaatttgattgcggatgacggtgagaccacca |
330 |
Q |
| |
|
|||||||| ||||||||| |||| || || | ||||| || |||||||||||||||||||| |||||| | |||||||| |
|
|
| T |
30453113 |
cgccattccggcttgaagcgccaaaacagtgccgtggtgaatgtgtcccaatttgattgcgggtgacggggcgaccacca |
30453034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University