View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8795_low_8 (Length: 241)
Name: NF8795_low_8
Description: NF8795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8795_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 20 - 182
Target Start/End: Original strand, 17472454 - 17472616
Alignment:
| Q |
20 |
tctgacactgggacatggttaatgcgagaagtgtctgtgtgcttaagtaagtggttttgagttaggatttgaagctgaaaaacggtatatagtgaatgga |
119 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17472454 |
tctgacattgggacatgcttaatgcgagaagtgtctgtgtgcttaagtaagtggttttgagttaggatttgaagctgaaaaatggtatatagtgaatgga |
17472553 |
T |
 |
| Q |
120 |
tgattgttgtcctttaatagctgctgtgaatctgtcatcatcattcatcatttgatttggatt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17472554 |
tgattgttgtcctttaatagctgctgtgaatctgtcatcatcattcatcatttgatttggatt |
17472616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University