View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8796_high_4 (Length: 261)
Name: NF8796_high_4
Description: NF8796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8796_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 15 - 260
Target Start/End: Original strand, 8490997 - 8491242
Alignment:
| Q |
15 |
attgcttaccctcttcagttgttgagtttgtgctatcacaccaaattgcttccctaatgcgaggaggtgcaaatgctgacccttcatgaaatgatgaatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8490997 |
attgcttaccctcttcagttgttgagtttgtgctatcacaccaaattgcttccctaatgcgaggaggtgcaaatgctgacccttcatgaaatgatgaatg |
8491096 |
T |
 |
| Q |
115 |
atgacctaaaggaactccaagaagagatgaagttgccacaacccctcccaatgaacgcataagttctccctgcgttacaaaaccaactgcaaagattaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8491097 |
atgacctaaaggaactccaagaagagatgaagttgccgcaacccctcccaatgaacgcataagttctccctgcgttacaaaaccaactgcaaagattaat |
8491196 |
T |
 |
| Q |
215 |
cccacgaaacaactgagatccacataagaagttcatctcactcgac |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || ||||||||| |
|
|
| T |
8491197 |
cccacgaaacaactgagattcacataagaagttgatatcactcgac |
8491242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 187
Target Start/End: Original strand, 8474041 - 8474207
Alignment:
| Q |
21 |
taccctcttcagttgttgagtttgtgctatcacaccaaattgcttccctaatgcgaggaggtgcaaatgctgacccttcatgaaatgatgaatgatgacc |
120 |
Q |
| |
|
|||| ||||| ||||| |||||||| ||| |||||||||| || |||||||||||||||||||||||||| | ||||| | | ||||| |||| |||||| |
|
|
| T |
8474041 |
taccttcttcggttgtcgagtttgtactaccacaccaaatggcctccctaatgcgaggaggtgcaaatgcaggcccttgaaggaatgaggaattatgacc |
8474140 |
T |
 |
| Q |
121 |
taaaggaactccaagaagagatgaagttgccacaacccctcccaatgaacgcataagttctccctgc |
187 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| | |||||||| | ||||| |||||||||||| |
|
|
| T |
8474141 |
caaaggaactccaagaagcgatgaagttgcaacagcacctcccaaagcacgcacgagttctccctgc |
8474207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University