View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8797_low_5 (Length: 226)
Name: NF8797_low_5
Description: NF8797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8797_low_5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 16792810 - 16793035
Alignment:
| Q |
1 |
gtagagtcgttgtgttcctcggctagttgatggttttggattgtgaccttcatttgttccgtttatatgatctagttctgataaatttgtagcacaaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16792810 |
gtagagtcgttgtgttcctcggctagttgatggttttggattgtgaccttcatttgttccgtttatatgatctagttctgataaatttgtagcacaaggt |
16792909 |
T |
|
| Q |
101 |
gcagctctcttccacagcttgctaaactttgaatcgcggttgcatcttgttaatgcaggaagtggaggaatatagctttgttttgaacctgaaaaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16792910 |
gcagctctcttccacagcttgctaaactttgaatcgcggttgcatcttgttaatgcaggaagtggaggaatatagctttgttttgaacctgaaaaagagt |
16793009 |
T |
|
| Q |
201 |
gtactttaaaagttaaaacctgtttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16793010 |
gtactttaaaagttaaaacctgtttt |
16793035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 196
Target Start/End: Complemental strand, 32735145 - 32735086
Alignment:
| Q |
137 |
cggttgcatcttgttaatgcaggaagtggaggaatatagctttgttttgaacctgaaaaa |
196 |
Q |
| |
|
|||||||||||||| |||| ||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
32735145 |
cggttgcatcttgtcaatggaggaagtaaaggaatgtaactttgttttgaacctgaaaaa |
32735086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University