View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8798_low_3 (Length: 399)
Name: NF8798_low_3
Description: NF8798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8798_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 112 - 307
Target Start/End: Complemental strand, 14452967 - 14452768
Alignment:
| Q |
112 |
acagtcaccaattctgtcgggtgcatgtaccccctactcccagctactgatattgccttcgacaccgatggaagt----gtggccttccatcgtttcaac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14452967 |
acagtcaccaattctgtcgggtgcatgtaccccctactcccagctactgatattgccttcgacaccgatggaagtaaccgtggccttccatcgtttcaac |
14452868 |
T |
|
| Q |
208 |
atgtaacatcgagaccaatcgatttctcgacaagaaagatgaaacaaactttcttctagcttcacttggcgctgtttaccgttagagcattcatatgcat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
14452867 |
atgtaacatcgagaccaatcgatttctcgacaagaaagatgaaacaaactctcttctagcttcacttggtgctgcttaccgttagagcattcatatgcat |
14452768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 15 - 54
Target Start/End: Complemental strand, 14453498 - 14453459
Alignment:
| Q |
15 |
caaacaactcatcaacacaagatatacatatttggcaaga |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14453498 |
caaacaactcatcaacacaagatatacatatttggcaaga |
14453459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 342 - 389
Target Start/End: Original strand, 45492085 - 45492132
Alignment:
| Q |
342 |
gtatatgtatattttcacagagacatgtataactaccatgaagaatta |
389 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| |||| |||||||| |
|
|
| T |
45492085 |
gtataagtatattttcatagagacatgtataactgccatcaagaatta |
45492132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University