View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8800_low_6 (Length: 313)
Name: NF8800_low_6
Description: NF8800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8800_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 154 - 296
Target Start/End: Complemental strand, 31636105 - 31635963
Alignment:
| Q |
154 |
cattactattgaatgcaactaataaacaaaatgaaagtaacacacaaacacctccaccatggatattaatttaagaaaatgaaagtaaattaaatattcg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31636105 |
cattactattgaatgcaactaataaacaaaatgaaagtaacacacaaacaccaccaccactgatattaatttaagaaaataaaagtaaattaaatattcg |
31636006 |
T |
 |
| Q |
254 |
tgtcaatgttgaatagacacatgtggttatcggatattccttc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31636005 |
tgtcaatgttgaatagacacatgtggttatcggatattccttc |
31635963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 12 - 77
Target Start/End: Complemental strand, 31636247 - 31636182
Alignment:
| Q |
12 |
aagcagagactgtaagttatgattttatctcttttctattgaaattgattttttcaagatctaacc |
77 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31636247 |
aagcagacactgtaagttatgattttatctcttttctattgaaattgattttttcaagatctaacc |
31636182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University