View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8801_low_9 (Length: 204)
Name: NF8801_low_9
Description: NF8801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8801_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 24830979 - 24831149
Alignment:
| Q |
16 |
atgaatcattatttgctctcattttgcatgcatgtaaaatgaaatgtacacagagacatccaattcgtatcatatagatccatggaatgaagctgagcct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24830979 |
atgaatcattatttgctctcattttgcatgcatgtaaaatgaaatgtacacagagacatccaattcgtatcatatagatccatggaatgaagctgagcct |
24831078 |
T |
|
| Q |
116 |
taccctttctactagcgaatcggaacaaccattgaatgagagacaattttttcccccacagctgtatctgt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24831079 |
taccctttctactagcgaatcggaacaaccattgaatgagagacaatttttttccccacagctgtatctgt |
24831149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 91 - 159
Target Start/End: Original strand, 814968 - 815036
Alignment:
| Q |
91 |
agatccatggaatgaagctgagccttaccctttctactagcgaatcggaacaaccattgaatgagagac |
159 |
Q |
| |
|
||||||||| ||||||| ||||||||||| |||||||||||||||| | |||||||||||||| ||||| |
|
|
| T |
814968 |
agatccatgaaatgaaggtgagccttaccgtttctactagcgaatctgcacaaccattgaatgggagac |
815036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University