View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8803_high_5 (Length: 285)
Name: NF8803_high_5
Description: NF8803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8803_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 157 - 269
Target Start/End: Complemental strand, 43368657 - 43368545
Alignment:
| Q |
157 |
ggctttaaaagcaaaaatgaatagggaagtagaagaatttgcccgaagattaaattcttcccgggaagagaggataaaagacttttcttcatcatcgcaa |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43368657 |
ggctttaaaagcaaaaatgaatagggaagtagaagaatttgcccgaagattaaattcttcccgggaagagaggataaaagacttttcttcatcatcgcaa |
43368558 |
T |
|
| Q |
257 |
gaaaggaaattgg |
269 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43368557 |
gaaaggaaattgg |
43368545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 11 - 97
Target Start/End: Complemental strand, 43368815 - 43368729
Alignment:
| Q |
11 |
aagaatgtgaaggttaacgtcggtcataacaacatcaaacaccaaagttcggaagtagataaactgtgtgagacctcaaatttacac |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43368815 |
aagaatgtgaaggttaacgtcggtcataacaacatcaaacaccaaagttcggaagtagataaactgtgtgagacctcaaatttacac |
43368729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 155 - 263
Target Start/End: Complemental strand, 43364523 - 43364415
Alignment:
| Q |
155 |
ccggctttaaaagcaaaaatgaatagggaagtagaagaatttgcccgaagattaaattcttcccgggaagagaggataaaagacttttcttcatcatcgc |
254 |
Q |
| |
|
||||| ||| |||||| ||| |||||||||| |||||||||||||| |||||||||| |||| | ||||||| ||| ||||||||||||| ||| ||| |
|
|
| T |
43364523 |
ccggccttacaagcaagaattgatagggaagtggaagaatttgcccgcagattaaattgttccttgcaagagagaatacaagacttttcttcgtcagcgc |
43364424 |
T |
|
| Q |
255 |
aagaaagga |
263 |
Q |
| |
|
| ||||||| |
|
|
| T |
43364423 |
aggaaagga |
43364415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 264
Target Start/End: Original strand, 11369790 - 11369875
Alignment:
| Q |
179 |
agggaagtagaagaatttgcccgaagattaaattcttcccgggaagagaggataaaagacttttcttcatcatcgcaagaaaggaa |
264 |
Q |
| |
|
|||||||| ||||| |||||||| |||||||||||| | || |||||| ||||||||||||| ||||| || ||||||||||| |
|
|
| T |
11369790 |
agggaagtggaagattttgcccgcagattaaattctgactggccagagagaataaaagactttttgtcatcctcacaagaaaggaa |
11369875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University