View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8804_high_9 (Length: 272)
Name: NF8804_high_9
Description: NF8804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8804_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 10 - 180
Target Start/End: Original strand, 32059927 - 32060097
Alignment:
| Q |
10 |
tgaataatagcaatattgttgcaagagatagcacatgcttgaggattggaggaatgccaacaagaagcaacagtcacaacacatacagtctggtaatgca |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
32059927 |
tgaataatagaaatattgttgcaagagataacacatgcttgaggattggaggaatgccaacaagaagcaacagtcacaactcatacagtctagtgatgca |
32060026 |
T |
 |
| Q |
110 |
gctgctgtcacgctgcaaacagcagaacaaggctcgggcagcaagaatgttggacagagatggaagaagcc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
32060027 |
gctgctgtcacgctgcaaacagcagaacaaggctcgggcaacaagaatgttggacagaaatggaagaagcc |
32060097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 81
Target Start/End: Complemental strand, 14945594 - 14945552
Alignment:
| Q |
39 |
agcacatgcttgaggattggaggaatgccaacaagaagcaaca |
81 |
Q |
| |
|
||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
14945594 |
agcacttgcttgaggattgtaggactgccaacaagaagcaaca |
14945552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University