View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8804_low_12 (Length: 257)

Name: NF8804_low_12
Description: NF8804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8804_low_12
NF8804_low_12
[»] chr5 (1 HSPs)
chr5 (1-144)||(7399637-7399780)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 7399637 - 7399780
Alignment:
1 ggctaatatgactgacaaatcttattttgattgctaaagagatcaatcgagttggactttaaggaagtgttgcaagccctacataggtggaaacaagatt 100  Q
    |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||    
7399637 ggctaatatgactgacaagtcttattttaattgctaaagagatcaatcgagttggactttaaggaagtgttgcaagccctacataggcgaaaacaagatt 7399736  T
101 taagttatgatttttaaatgacaaaattatatacataatccctt 144  Q
    ||||||||||||||||||||||||||||| ||| ||| ||||||    
7399737 taagttatgatttttaaatgacaaaattacatatatagtccctt 7399780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University