View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8804_low_12 (Length: 257)
Name: NF8804_low_12
Description: NF8804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8804_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 7399637 - 7399780
Alignment:
| Q |
1 |
ggctaatatgactgacaaatcttattttgattgctaaagagatcaatcgagttggactttaaggaagtgttgcaagccctacataggtggaaacaagatt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
7399637 |
ggctaatatgactgacaagtcttattttaattgctaaagagatcaatcgagttggactttaaggaagtgttgcaagccctacataggcgaaaacaagatt |
7399736 |
T |
 |
| Q |
101 |
taagttatgatttttaaatgacaaaattatatacataatccctt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||| |||||| |
|
|
| T |
7399737 |
taagttatgatttttaaatgacaaaattacatatatagtccctt |
7399780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University