View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8805_high_5 (Length: 371)
Name: NF8805_high_5
Description: NF8805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8805_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 4055117 - 4055271
Alignment:
| Q |
1 |
atattactgttatgcccttcactctcaaagtcaaaaagtgttgaacttgttacttgtgatgatnnnnnnnttgatcttggttccatagctatagcttttg |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4055117 |
atatcactgttatgcccttcactctcaaagtcaaaaagtgttgaacttgttacttgtgatgatgaaaaaattgatcttggttccatagctatagcttttg |
4055216 |
T |
|
| Q |
101 |
ggttagacccatcaacgttgaggttgaatggttactttataagtagaggagttga |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4055217 |
ggttagacccatcaacgttgaggttgaatggttactttataagtagaggagttga |
4055271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 208 - 288
Target Start/End: Original strand, 4055324 - 4055405
Alignment:
| Q |
208 |
agaggtttgtctactgggaaaagtaaccatgatgctattgttgttactggcaaagatgttaacaagggta-tgtttgtcaag |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4055324 |
agaggtttgtctactgggaaaagtaaccatgatgctattgttgttactggcaaagatgttaacaagggtattgtttgtcaag |
4055405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University