View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8805_low_9 (Length: 222)
Name: NF8805_low_9
Description: NF8805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8805_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 205
Target Start/End: Original strand, 44690001 - 44690194
Alignment:
| Q |
12 |
gagaagaatgctgatcgagctgaagtctattttgatagagctattcaaagtgatccaaatgattggtaagataaatcttaaatctatgtggattatgtct |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44690001 |
gagaagaatgctgatcgagctgaagcctattttgatagagctattcaaagtgatccaaatgattggtaagataaatcttaaatctatgtggattatgtct |
44690100 |
T |
 |
| Q |
112 |
tttcctctatgcatatacattctcctaatttttgcatgaaatttattgtttgaacatcaaactagagacattatatatgtgacatggtagatgt |
205 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44690101 |
tttcctctatgtatatacattctcctaatttttgcatgaaatttattgtttgaacatcaaactagagacattatatatgtgacatggtagatgt |
44690194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University