View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8806_low_10 (Length: 306)
Name: NF8806_low_10
Description: NF8806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8806_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 42633706 - 42633996
Alignment:
| Q |
1 |
tttttaaatgaatgagatgatatattattgtcatgtaattttaattactgaaacagtttaaaa-aattaacctccctgctctcttttacagcagagtgtc |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42633706 |
tttttagatgaatgagatgatatattattgtcatgtaattttaattactgaaacagttaaaaaaaattaacccccctgctctcttttacagcagagtgtc |
42633805 |
T |
 |
| Q |
100 |
tctcaaatttcatttggcgtttagtaattttcactttgctcttttctacactttcattttgcagatatgaaataatttggcaactaagtcatttgactgt |
199 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42633806 |
tttcatatttcatttggcgtttagtaattttcacttggctcttttctacactttcattttgcagatatgaaataatttggcaactaagtcatttgactgt |
42633905 |
T |
 |
| Q |
200 |
cctatcattctgattctgatattgtactaaaacccctagttgaaaatttaatccctaacatgtttcttgtacaagattctgttataccaat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42633906 |
cctatcattctgattctgatattgtactaaaacccctagttgaaaatttaatccctaacatgtttcttgtacaagattctgttataccaat |
42633996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University