View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8806_low_6 (Length: 377)
Name: NF8806_low_6
Description: NF8806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8806_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 26881487 - 26881255
Alignment:
| Q |
18 |
gaaacatgtatgaggtctcttgcatctttggcattacatagaaatttcaatgtaaaaagtaaattattgttgaaagaactctaatattacacttgtttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26881487 |
gaaacatgtatgaggtctcttgcatctttggcattacatagaaatttcaatgtaaaaagtaaattattgttgaaagaactctaatattacacttgtttgg |
26881388 |
T |
|
| Q |
118 |
atactcaaggaatgtggatttgatctcccatggaactaatgcttatatagttttgattttgcaatttataacgttgtgtagaatgtacggg--ga-ttct |
214 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
26881387 |
atactcaaggaatttggatttgatctcccatggaactaatgcttatatagttttgattttgcaatttataacgttgtgtagaatgtacgggatgagttct |
26881288 |
T |
|
| Q |
215 |
tgcatcttgattagttttacaatttataaccta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26881287 |
tgcatcttgattagttttacaatttataaccta |
26881255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 302 - 377
Target Start/End: Complemental strand, 26881250 - 26881175
Alignment:
| Q |
302 |
tgtgttcttctcttgttccctaattcccgcctggttgcttcctcgattggaacataaactcctattaaaacaacct |
377 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26881250 |
tgtgttcttctcttgttccgtaattcccgcctcgttgcttcctcgattagaacataaactcctattaaaacaacct |
26881175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University