View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8807_low_4 (Length: 244)
Name: NF8807_low_4
Description: NF8807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8807_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 7 - 121
Target Start/End: Complemental strand, 20285159 - 20285046
Alignment:
| Q |
7 |
tttggtgttcatctatttgtaaagaactattttgtttctctgatttttcatgttctgctgttgagcttggaagcagggtacccatcccttctctattgtc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20285159 |
tttggtgttcatctatttgtaaagaactattttgtttctctgatttttcatgttctgctgttgagcttggaagcagggtacccatcccttctctattgtc |
20285060 |
T |
 |
| Q |
107 |
ttagcctctaacaaa |
121 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
20285059 |
-tatcctctaacaaa |
20285046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 113 - 226
Target Start/End: Complemental strand, 20285028 - 20284908
Alignment:
| Q |
113 |
tctaacaaattattatcaatattagaggatggaaggtgtataaatactatact------tata-aaata-atttatatatagtggagccgtggaccgttt |
204 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |||| | ||| || ||||||||||||||||||||||| || |
|
|
| T |
20285028 |
tctaacagattattgtcaatattagaggatggaatgtgtataaatactatactatagtctatatatatatatatatatatagtggagccgtggaccactt |
20284929 |
T |
 |
| Q |
205 |
tgctttaaatactatttaatat |
226 |
Q |
| |
|
| | |||||||||||||||||| |
|
|
| T |
20284928 |
ttc-ttaaatactatttaatat |
20284908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University