View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8807_low_5 (Length: 205)
Name: NF8807_low_5
Description: NF8807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8807_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 49 - 189
Target Start/End: Complemental strand, 33288926 - 33288786
Alignment:
| Q |
49 |
tcaattcacaacgatggcgttgaacgatcaaaatcaggcacaaatggctctaattctaggaccagattcaacccacttcgaatccctaatcacaaacctc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33288926 |
tcaattcacaacgatggcgttgaacgatcaaaatcaagcacaaatggctctaattctaggaccagattcaacccacttcgaatccctaatcacaaacctc |
33288827 |
T |
 |
| Q |
149 |
atgtccaccatcaacgaccaacgttcccaagctgaaaatct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33288826 |
atgtccaccatcaacgaccaacgttcccaagctgaaaatct |
33288786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University