View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8808_high_6 (Length: 209)

Name: NF8808_high_6
Description: NF8808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8808_high_6
NF8808_high_6
[»] chr2 (1 HSPs)
chr2 (18-196)||(37755619-37755797)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 37755797 - 37755619
Alignment:
18 agaagcttgactctttatacttttgggcaaatgcctgtttcgggcaaccaccagaaaaaataaacatgcacctagaaacaggcatgcattgtcatagtca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37755797 agaagcttgactctttatacttttgggcaaatgcctgtttcgggcaaccaccagaaaaaataaacatgcacctagaaacaggcatgcattgtcatagtca 37755698  T
118 tagataagtattggatgaaagatgttatcgaatgtcaaaaggattggagataagattattagctctaaagaatatggtg 196  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||    
37755697 tagataagtattggatgaaagatgttatcgaatgtcaaaagggttggaaataagattattagctctaaagaatatggtg 37755619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University