View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8808_low_6 (Length: 209)
Name: NF8808_low_6
Description: NF8808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8808_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 37755797 - 37755619
Alignment:
| Q |
18 |
agaagcttgactctttatacttttgggcaaatgcctgtttcgggcaaccaccagaaaaaataaacatgcacctagaaacaggcatgcattgtcatagtca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37755797 |
agaagcttgactctttatacttttgggcaaatgcctgtttcgggcaaccaccagaaaaaataaacatgcacctagaaacaggcatgcattgtcatagtca |
37755698 |
T |
 |
| Q |
118 |
tagataagtattggatgaaagatgttatcgaatgtcaaaaggattggagataagattattagctctaaagaatatggtg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37755697 |
tagataagtattggatgaaagatgttatcgaatgtcaaaagggttggaaataagattattagctctaaagaatatggtg |
37755619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University