View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8809_high_2 (Length: 336)
Name: NF8809_high_2
Description: NF8809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8809_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 7 - 325
Target Start/End: Complemental strand, 30907449 - 30907131
Alignment:
| Q |
7 |
aaaactaatgttccggtggaggtgcagttgattttgtatgattggtcaccgcaggttggggtggtgctgagtgggaaagggacggtggtgttgccgcagg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30907449 |
aaaactaatgttccggtggaggtgcagtttattttgtatgattggtcaccgcaggttggggtggtgctgagcgggaaagggacggtggtgttgccgcagg |
30907350 |
T |
 |
| Q |
107 |
gtggacatggtgtggcggagaagacatgggtggtgcatgttagcaggaggagtgttgatgttacaaggaggaagctcgttgtcttcatagtcaaactaat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30907349 |
gtggacatggtgtggcggagaagacatgggtggtgcatgttagcaggaggagtgtcgatgttacaaggaggaagctcgttgtcttcatagtcaaactaat |
30907250 |
T |
 |
| Q |
207 |
gtatgtgcaaatttggaagatcaatattggtgatgttactttatatatagtagttgtataatagtgtgatcttgctttgagattgcaatagactaacttt |
306 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30907249 |
gtatgtgcaaatttagaagatcaatgttggtgatgttactttatatatagtagttgtataatagtgtgatcttgctttgagattgcaatagactaacttt |
30907150 |
T |
 |
| Q |
307 |
tatatgacattttgttctt |
325 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30907149 |
tatatgacattttgttctt |
30907131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University