View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_high_21 (Length: 299)
Name: NF8810A_high_21
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 17 - 275
Target Start/End: Complemental strand, 44826925 - 44826667
Alignment:
| Q |
17 |
catcaaagtcaaggtcgatgtcaagaaagagcaaatctaagaagttcaaatattcttcaaaatcttgtggacttccatccaaatggaaaagaagaagaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44826925 |
catcaaagtcaaggtcgatgtcaagaaagagcaaatctaagaagttcaaatattcttcaaaatcttgtggacttccatccaaatggaaaagaagaagaaa |
44826826 |
T |
|
| Q |
117 |
taccgatgagaaaaacaaactggaaaagcactatacaccttgtgaatgtgagggggcgtgtggaaagcaatgtacatgtcgtcttaatggttattgctgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
44826825 |
taccgatgagaaaaacaaactggaaaagcactatacaccttgtgaatgtgagggggcgtgtggaaagcaatgtccatgtcgtcttaatggtttttgctgt |
44826726 |
T |
|
| Q |
217 |
gaaaaatattgtgggtatgtcaattttcatttaattatgttacttttcgatggaaaaca |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44826725 |
gaaaaatattgtgggtatgtcaattttcatttaattatgttacttttcgatggaaaaca |
44826667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University