View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_high_28 (Length: 228)
Name: NF8810A_high_28
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 55161369 - 55161145
Alignment:
| Q |
1 |
gggaaaggaataattaattaattaagaaccatagaaagaagaaacccccatcatgagtatcactagaagtagaagaaggaagaaaaatatatgaatggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55161369 |
gggaaaggaataattaattaattaagaaccatagaaagaagaaacccccatcatcagtatcactagaagtagaagaaggaagaaaaatatatgaatggta |
55161270 |
T |
|
| Q |
101 |
gtatggaatgaaataggttgcatcatcatccttgggaatttgaaagttact--------------tactactactgcctgtgttaagtatcatatgaaac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
55161269 |
gtatggaatgaaataggttgcatcatcatccttgggaatttgaaaggtacttactagttacttactactactactgcctgtgttaagtagcatatgaaac |
55161170 |
T |
|
| Q |
187 |
aaaaatgaatagatgggattggattggag |
215 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
55161169 |
aaa----aatagatgggattggattggag |
55161145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University