View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_high_5 (Length: 561)
Name: NF8810A_high_5
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 8e-84; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 141 - 354
Target Start/End: Original strand, 26328346 - 26328557
Alignment:
| Q |
141 |
tttgattggagtatactaatactatgaactagcaacagctggcaatgtttttgtcgtacttgacactcaacctcaacaaccaatgaaattaagccacgtc |
240 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26328346 |
tttgattggagtatactgatactatgaactagcaacagctggcaatgtttttgtcgtacttgacactcaacctcaacaaccaatgaaattaagacacgtc |
26328445 |
T |
|
| Q |
241 |
aatccactttttcattaatactctcac----agtcacataacaaattagttcttatcttgaagttgaaacatctttattaacttccataacgattttacc |
336 |
Q |
| |
|
| ||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26328446 |
atcccattttttcattaatactctcacatatagtcacataacaaattagttcttatc------ttgaaacatctttattaacttccataacgattttacc |
26328539 |
T |
|
| Q |
337 |
gataatttgccagctcag |
354 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26328540 |
gataatttgccagctcag |
26328557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 11 - 86
Target Start/End: Original strand, 26328217 - 26328291
Alignment:
| Q |
11 |
atgaagaaaggtatttccaaaaatagagtaaaaatatttaaatgcaacttgtaaacatgtgaaagcaatgctccat |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26328217 |
atgaagaaaggtatttccaaaaatagagtaaaaatatttaaatgc-acttgtaaacatgtgaaagcaatgctccat |
26328291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 424 - 491
Target Start/End: Original strand, 26328627 - 26328694
Alignment:
| Q |
424 |
tttcagtttcttgttccaatcttgttcacaattcaatcttttatatctaaatccaaactttaaagatt |
491 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26328627 |
tttcagtttcttgttccaatcttgttcacaattcaatcttttatatctaaatccaaaccttaaagatt |
26328694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 517 - 561
Target Start/End: Original strand, 26328721 - 26328765
Alignment:
| Q |
517 |
catcttcagaaaatgtcgaatatagaagaaaattcatctcctcct |
561 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26328721 |
catcttcagaaaatgtcgaatatagaagaaaattcatctcctcct |
26328765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University