View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_106 (Length: 303)
Name: NF8810A_low_106
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_106 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 8 - 303
Target Start/End: Original strand, 48671972 - 48672267
Alignment:
| Q |
8 |
agcatagacttaattgaaattggtggcgaagctctcaaaactaacatcacaacactaggaccattggtcctacccttttcagaacagcttattttctttg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48671972 |
agcaaagacttaattgaaattggtggcgaagctctcaaaactaacatcacaacactaggaccattggtcctacccttttcagaacagcttattttctttg |
48672071 |
T |
|
| Q |
108 |
ctacattagtgtggaggaactggtttggtggtggaaaatctgataaaaattcaccatcatcaaacaagccatacattcctaactacaaactagcttttga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48672072 |
ctacattagtgtggaggaactggtttggtggtggaaaatctgataaaaattcaccatcatcaaacaagccatacattcctaactacaaactagcttttga |
48672171 |
T |
|
| Q |
208 |
gcatttttgtgtgcatgctgctagcaaaaccattcttgatgagcttcaaaagaatcttgaattgagtgacaagaacatggaagcttctagaatgac |
303 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48672172 |
gcatttttgtgtgcatgctgccagcaaaaccattcttgatgagcttcaaaagaatcttgaattgagtgacaagaacatggaagcttctagaatgac |
48672267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 35 - 81
Target Start/End: Original strand, 15239322 - 15239368
Alignment:
| Q |
35 |
gaagctctcaaaactaacatcacaacactaggaccattggtcctacc |
81 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||||||| |||||||| |
|
|
| T |
15239322 |
gaagcactcaaaacaaacatcacaacattaggaccattagtcctacc |
15239368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University