View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_125 (Length: 294)
Name: NF8810A_low_125
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_125 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 155 - 288
Target Start/End: Complemental strand, 38708151 - 38708014
Alignment:
| Q |
155 |
gtatttattaggatagatttgaaagaaaaataattactccttgaaaagactagccgctagcc----tatcctcagaacttaaaacacctatgggattggt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
38708151 |
gtatttattaggatagatttgaaagaaaaataattactccttgaaaagactagccgctagcctatctatcctcggaacttaaaacacctatgggattggt |
38708052 |
T |
|
| Q |
251 |
ttttggtccatgtctttatgaactaaccaagtgtcttt |
288 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38708051 |
ttttggtctatgtctttatgaactaaccaagtgtcttt |
38708014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 78 - 139
Target Start/End: Complemental strand, 38708865 - 38708804
Alignment:
| Q |
78 |
atctttgtggatatttgactttgtaaaactattcctaaaacttgacaatgttgcctaattat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
38708865 |
atctttgtggatatttgactttgtaaaaccattcctaaaactggacaatgttgcccaattat |
38708804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 38709871 - 38709824
Alignment:
| Q |
15 |
aaacacattgattgcttttgaccttcttaattttttcatataaaccaa |
62 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38709871 |
aaacacattgattgcttttgaccctcttaattttttcatataaaccaa |
38709824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University