View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_155 (Length: 272)
Name: NF8810A_low_155
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_155 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 32 - 272
Target Start/End: Original strand, 376976 - 377216
Alignment:
| Q |
32 |
ggctccgtctagcgtgagcggccaatatgggtctctcattgtgcaaatgagtttataaccgcatgatataagattaaaatatttgatggtcaagatgctt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
376976 |
ggctccgtctagcgtgagcggccaatatgggtctttcattgtgcaaatgagtttataaccgcatgatataagattaaaatatttgatggtcaagatgctt |
377075 |
T |
|
| Q |
132 |
tacctataacttgtttaaacctgattcaacagtttatggcacatttttaacatttggcacgtcgactatactaatttaaatttaaatttacgagagcacc |
231 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
377076 |
tatctataacttgtttaaacctgattcaacagtttgtggcacatttttaacatttggcacgtcgactatactaattaaaatttaaatttacgagaacacc |
377175 |
T |
|
| Q |
232 |
cattatttatgtttattttcagtgacctccatgcttaatga |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
377176 |
cattatttatgtttattttcagtgacctccatgcttaatga |
377216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University