View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_158 (Length: 270)
Name: NF8810A_low_158
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_158 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 39 - 258
Target Start/End: Original strand, 4435964 - 4436182
Alignment:
| Q |
39 |
ttgcaaccacgcccttttatattaataaaagaaacccatatatactcgttaattatatttgcgacctataaaatgatgttaatcctttgatattcaagga |
138 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4435964 |
ttgcaaccatgcccttttatattaataaaagaaacccatatatactcgttaattatatctgcgacctataaaatgatgttaatcctttgatattcaagga |
4436063 |
T |
|
| Q |
139 |
gaagacactctagtaattacaagttcggtgaaaagctnnnnnnngtttgatcagtcatagtttcaattagaatttggtctcaannnnnnnnnactgaaat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4436064 |
gaagacactctagtaattacaagttcggtgaaaagctaaaaaaagtttgatcaatcatagtttcaattagaatttggtctcaa-ttttttttactgaaat |
4436162 |
T |
|
| Q |
239 |
ttattccccagttggatatt |
258 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4436163 |
ttattccccagttggatatt |
4436182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University