View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_160 (Length: 269)
Name: NF8810A_low_160
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_160 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 50 - 179
Target Start/End: Complemental strand, 37385434 - 37385305
Alignment:
| Q |
50 |
tcaaacgcaaaggaacgacggaaatggacggagacgaaggacacgacaaatcgggcggccgaatttaactgtttatttgggtcccaccannnnnnnatat |
149 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37385434 |
tcaaacgcaaaggaacgacgggaatggacggagacgaaggacacgacaaatcgggcggccgaatttaactgtttatttgggtcccaccatttttttatat |
37385335 |
T |
|
| Q |
150 |
ttcatcaaattacttcatgcctttataaaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37385334 |
ttcatcaaattacttcatgcctttataaaa |
37385305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 170 - 217
Target Start/End: Complemental strand, 37385121 - 37385074
Alignment:
| Q |
170 |
ctttataaaatacttttgaataggtctttgtctatgatattttaaatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37385121 |
ctttataaaatacttttgaataggtctttgtctatgatatttttaatg |
37385074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University