View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_168 (Length: 262)
Name: NF8810A_low_168
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_168 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 2 - 250
Target Start/End: Original strand, 3082360 - 3082608
Alignment:
| Q |
2 |
catacgtaacctaagtattcctttacttccaccttccttgtaagttgtaacgactttagagatattacgtgatatcttattgtttgtaatctgaaggcat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
3082360 |
catacgtaacctaagtattcctttacttccaccttccttgtaagttgtaacgactttagagatattacgtgatatcttactgtttgtaatctgaagacat |
3082459 |
T |
 |
| Q |
102 |
atgatggttttgaatgaagcaataataaatacagttctaaatgcccatggaatatttttatcacttcagaaacactttttcttgactgatattttttata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3082460 |
atgatggttttgaatgaagcaataataaatgcagttctaaatgcccatggaatatttttatcacttcagaaacactttttcttgactgatattttttata |
3082559 |
T |
 |
| Q |
202 |
tatgttcatgattatacaggggtatttcttagtacatttcatggatatt |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3082560 |
tatgttcatgattatacagggggatttcttagtacatttcatggatatt |
3082608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University