View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_184 (Length: 255)
Name: NF8810A_low_184
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_184 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 40514516 - 40514759
Alignment:
| Q |
1 |
gtatgtctttctacaaactggacatgtcaacttcattatcaaccaaggatcaacacaagcaacatgaaacaaatgaccacaaccaggaagcattctcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40514516 |
gtatgtctttctacaaactggacatgtcaacttcattatcaaccaaggatcaacacaagcaacatgaaacaaatgaccacaactaggaagcattctcaac |
40514615 |
T |
|
| Q |
101 |
aaatcagattctttataatccatcaaacatattgagcagcaacaactactaattgaattaatattattgctgttacataatttcacttcagataaatatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514616 |
aaatcagattctttataatccatcaaacatattgagcagcaacaactactaattgaattaatattattgctgttacataatttcacttcagataaatatg |
40514715 |
T |
|
| Q |
201 |
gtatagtcctaatttgatcattgcttctgcacacatttgtagta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40514716 |
gtatagtcctaatttgatcattgcttctacacacatttgtagta |
40514759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 190
Target Start/End: Original strand, 40509283 - 40509350
Alignment:
| Q |
120 |
ccatcaaacatattgagcagcaacaactactaattgaattaatattattgctgttacataatttcacttca |
190 |
Q |
| |
|
||||||| ||||| |||||||||||||||| |||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
40509283 |
ccatcaagcatatgaagcagcaacaactact---tgaattaatactattgctgttacacaatttgacttca |
40509350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University