View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_198 (Length: 251)
Name: NF8810A_low_198
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_198 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 250
Target Start/End: Complemental strand, 37661535 - 37661292
Alignment:
| Q |
3 |
tcgaccgaaagggagagggaagaggtacctctttttccaggcctgttcggacatacggttcccgcggaagatcaagttggtgagccgtgtgatgggaaac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37661535 |
tcgaccgaaagggagagggaagaggtacctctttttccaggcctgttc----attcggttcccgctgaagatcaagttggtgagccgtgtgatgggaaac |
37661440 |
T |
|
| Q |
103 |
cttcccgcacggttcggagagcactgaattagaatgagaggttcaccaccacatcattgcatgcaaggggagctcgctcgattcgcaaataggtccgact |
202 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37661439 |
cttcccgcacggttcagagagcactgaattagaatgagaggttcgccaccacatcattgcatgcaaggggagctcgctcgattcgcaaataggtccaact |
37661340 |
T |
|
| Q |
203 |
cgtaattcacttctgactccgtgttcgatagcccgaccgtagtgatgt |
250 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37661339 |
cgtaatttacttctgactccgtgttcgatagcccgaccatagtgatgt |
37661292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University